enhanced CraftNite cheat client.
// ==UserScript==
// @name CheatNite Enhanced
// @namespace CheatNite.discord
// @icon https://i.imgur.com/1ptl65c.png
// @version 1.5.7
// @description enhanced CraftNite cheat client.
// @author towelgreen, (and kᵏ a little)
// @match https://craftnite.io/*
// @run-at document-start
// @license GPL-3.0
// @grant GM_addStyle
// @require https://greasyfork.org/scripts/475779-readschem/code/readschem.js?version=1253860
// ==/UserScript==
//constants
const yoClasses = ['RPCMatchRemainingTime', 'RPCa822erScore', 'CMDChunkBuffered', 'a201', 'a202', 'a199', 'a200', 'a169', 'a130', 'a119', 'a129', 'a128', 'a186', 'a222ingSoon', 'a124', 'a125', 'a126', 'RPCEndMatch', 'a188', 'a236', 'a189', 'a190', 'a191', 'a192', 'a193', 'a175', 'a194', 'a234', 'a171', 'a121', 'a172', 'a173', 'a174', 'a195', 'a180', 'a225', 'a226', 'a227', 'a228', 'a117', 'a118', 'a222']
const blocks = {"items":"items","random": "random", "air":0,"stone":256,"stone1":257,"stone2":258,"stone3":259,"stone4":260,"stone5":261,"stone6":262,"grass":512,"dirt":768,"dirt1":769,"dirt2":770,"cobblestone":1024,"planks":1280,"planks1":1281,"planks2":1282,"planks3":1283,"planks4":1284,"planks5":1285,"sapling":1536,"sapling1":1537,"sapling2":1538,"sapling3":1539,"sapling4":1540,"sapling5":1541,"bedrock":1792,"flowing_water":2048,"water":2304,"flowing_lava":2560,"lava":2816,"sand":3072,"sand1":3073,"gravel":3328,"gold_ore":3584,"iron_ore":3840,"coal_ore":4096,"log":4352,"log1":4353,"log2":4354,"log3":4355,"leaves":4608,"leaves1":4609,"leaves2":4610,"leaves3":4611,"sponge":4864,"sponge1":4865,"glass":5120,"lapis_ore":5376,"lapis_block":5632,"dispenser":5888,"sandstone":6144,"sandstone1":6145,"sandstone2":6146,"noteblock":6400,"bed":6656,"golden_rail":6912,"detector_rail":7168,"sticky_piston":7424,"web":7680,"tallgrass":7936,"tallgrass1":7937,"tallgrass2":7938,"deadbush":8192,"piston":8448,"piston_head":8704,"wool":8960,"wool1":8961,"wool2":8962,"wool3":8963,"wool4":8964,"wool5":8965,"wool6":8966,"wool7":8967,"wool8":8968,"wool9":8969,"wool10":8970,"wool11":8971,"wool12":8972,"wool13":8973,"wool14":8974,"wool15":8975,"piston_extension":9216,"yellow_flower":9472,"red_flower":9728,"red_flower1":9729,"red_flower2":9730,"red_flower3":9731,"red_flower4":9732,"red_flower5":9733,"red_flower6":9734,"red_flower7":9735,"red_flower8":9736,"brown_mushroom":9984,"red_mushroom":10240,"gold_block":10496,"iron_block":10752,"double_stone_slab":11008,"double_stone_slab1":11009,"double_stone_slab2":11010,"double_stone_slab3":11011,"double_stone_slab4":11012,"double_stone_slab5":11013,"double_stone_slab6":11014,"double_stone_slab7":11015,"double_stone_slab8":11016,"double_stone_slab9":11017,"double_stone_slab10":11023,"stone_slab":11264,"stone_slab1":11265,"stone_slab2":11266,"stone_slab3":11267,"stone_slab4":11268,"stone_slab5":11269,"stone_slab6":11270,"stone_slab7":11271,"stone_slab8":11272,"stone_slab9":11273,"stone_slab10":11274,"stone_slab11":11275,"stone_slab12":11276,"stone_slab13":11277,"stone_slab14":11278,"stone_slab15":11279,"brick_block":11520,"tnt":11776,"tnt1":11777,"bookshelf":12032,"mossy_cobblestone":12288,"obsidian":12544,"torch":12800,"torch1":12801,"torch2":12802,"torch3":12803,"torch4":12804,"fire":13056,"mob_spawner":13312,"oak_stairs":13568,"chest":13824,"redstone_wire":14080,"diamond_ore":14336,"diamond_block":14592,"crafting_table":14848,"wheat":15104,"farmland":15360,"furnace":15616,"lit_furnace":15872,"standing_sign":16128,"wooden_door":16384,"ladder":16640,"rail":16896,"stone_stairs":17152,"wall_sign":17408,"lever":17664,"stone_pressure_plate":17920,"iron_door":18176,"wooden_pressure_plate":18432,"redstone_ore":18688,"lit_redstone_ore":18944,"unlit_redstone_torch":19200,"unlit_redstone_torch1":19201,"unlit_redstone_torch2":19202,"unlit_redstone_torch3":19203,"unlit_redstone_torch4":19204,"redstone_torch":19456,"redstone_torch1":19457,"redstone_torch2":19458,"redstone_torch3":19459,"redstone_torch4":19460,"stone_button":19712,"snow_layer":19968,"ice":20224,"snow":20480,"cactus":20736,"clay":20992,"reeds":21248,"jukebox":21504,"jukebox1":21505,"fence":21760,"pumpkin":22016,"netherrack":22272,"soul_sand":22528,"glowstone":22784,"portal":23040,"lit_pumpkin":23296,"cake":23552,"unpowered_repeater":23808,"powered_repeater":24064,"stained_glass":24320,"stained_glass1":24321,"stained_glass2":24322,"stained_glass3":24323,"stained_glass4":24324,"stained_glass5":24325,"stained_glass6":24326,"stained_glass7":24327,"stained_glass8":24328,"stained_glass9":24329,"stained_glass10":24330,"stained_glass11":24331,"stained_glass12":24332,"stained_glass13":24333,"stained_glass14":24334,"stained_glass15":24335,"trapdoor":24576,"monster_egg":24832,"monster_egg1":24833,"monster_egg2":24834,"monster_egg3":24835,"monster_egg4":24836,"monster_egg5":24837,"stonebrick":25088,"stonebrick1":25089,"stonebrick2":25090,"stonebrick3":25091,"brown_mushroom_block":25344,"red_mushroom_block":25600,"iron_bars":25856,"glass_pane":26112,"melon_block":26368,"pumpkin_stem":26624,"melon_stem":26880,"vine":27136,"fence_gate":27392,"brick_stairs":27648,"stone_brick_stairs":27904,"mycelium":28160,"waterlily":28416,"nether_brick":28672,"nether_brick_fence":28928,"nether_brick_stairs":29184,"nether_wart":29440,"enchanting_table":29696,"brewing_stand":29952,"cauldron":30208,"end_portal":30464,"end_portal_frame":30720,"end_stone":30976,"dragon_egg":31232,"redstone_lamp":31488,"lit_redstone_lamp":31744,"double_wooden_slab":32000,"double_wooden_slab1":32001,"double_wooden_slab2":32002,"double_wooden_slab3":32003,"double_wooden_slab4":32004,"double_wooden_slab5":32005,"wooden_slab":32256,"wooden_slab1":32257,"wooden_slab2":32258,"wooden_slab3":32259,"wooden_slab4":32260,"wooden_slab5":32261,"cocoa":32512,"sandstone_stairs":32768,"emerald_ore":33024,"ender_chest":33280,"tripwire_hook":33536,"tripwire":33792,"emerald_block":34048,"spruce_stairs":34304,"birch_stairs":34560,"jungle_stairs":34816,"command_block":35072,"beacon":35328,"cobblestone_wall":35584,"cobblestone_wall1":35585,"flower_pot":35840,"carrots":36096,"potatoes":36352,"wooden_button":36608,"skull":36864,"anvil":37120,"trapped_chest":37376,"light_weighted_pressure_plate":37632,"heavy_weighted_pressure_plate":37888,"unpowered_comparator":38144,"powered_comparator":38400,"daylight_detector":38656,"redstone_block":38912,"quartz_ore":39168,"hopper":39424,"quartz_block":39680,"quartz_block1":39681,"quartz_block2":39682,"quartz_stairs":39936,"activator_rail":40192,"dropper":40448,"stained_hardened_clay":40704,"stained_hardened_clay1":40705,"stained_hardened_clay2":40706,"stained_hardened_clay3":40707,"stained_hardened_clay4":40708,"stained_hardened_clay5":40709,"stained_hardened_clay6":40710,"stained_hardened_clay7":40711,"stained_hardened_clay8":40712,"stained_hardened_clay9":40713,"stained_hardened_clay10":40714,"stained_hardened_clay11":40715,"stained_hardened_clay12":40716,"stained_hardened_clay13":40717,"stained_hardened_clay14":40718,"stained_hardened_clay15":40719,"stained_glass_pane":40960,"stained_glass_pane1":40961,"stained_glass_pane2":40962,"stained_glass_pane3":40963,"stained_glass_pane4":40964,"stained_glass_pane5":40965,"stained_glass_pane6":40966,"stained_glass_pane7":40967,"stained_glass_pane8":40968,"stained_glass_pane9":40969,"stained_glass_pane10":40970,"stained_glass_pane11":40971,"stained_glass_pane12":40972,"stained_glass_pane13":40973,"stained_glass_pane14":40974,"stained_glass_pane15":40975,"leaves2":41216,"leaves21":41217,"log2":41472,"log21":41473,"acacia_stairs":41728,"dark_oak_stairs":41984,"slime":42240,"barrier":42496,"iron_trapdoor":42752,"prismarine":43008,"prismarine1":43009,"prismarine2":43010,"sea_lantern":43264,"hay_block":43520,"carpet":43776,"carpet1":43777,"carpet2":43778,"carpet3":43779,"carpet4":43780,"carpet5":43781,"carpet6":43782,"carpet7":43783,"carpet8":43784,"carpet9":43785,"carpet10":43786,"carpet11":43787,"carpet12":43788,"carpet13":43789,"carpet14":43790,"carpet15":43791,"hardened_clay":44032,"coal_block":44288,"packed_ice":44544,"double_plant":44800,"double_plant1":44801,"double_plant2":44802,"double_plant3":44803,"double_plant4":44804,"double_plant5":44805,"standing_banner":45056,"wall_banner":45312,"daylight_detector_inverted":45568,"red_sandstone":45824,"red_sandstone1":45825,"red_sandstone2":45826,"red_sandstone_stairs":46080,"double_stone_slab2":46336,"double_stone_slab21":46344,"stone_slab2":46592,"stone_slab21":46600,"spruce_fence_gate":46848,"birch_fence_gate":47104,"jungle_fence_gate":47360,"dark_oak_fence_gate":47616,"acacia_fence_gate":47872,"spruce_fence":48128,"birch_fence":48384,"jungle_fence":48640,"dark_oak_fence":48896,"acacia_fence":49152,"spruce_door":49408,"birch_door":49664,"jungle_door":49920,"acacia_door":50176,"dark_oak_door":50432,"end_rod":50688,"chorus_plant":50944,"chorus_flower":51200,"purpur_block":51456,"purpur_pillar":51712,"purpur_stairs":51968,"purpur_double_slab":52224,"purpur_slab":52480,"end_bricks":52736,"beetroots":52992,"grass_path":53248,"end_gateway":53504,"repeating_command_block":53760,"chain_command_block":54016,"frosted_ice":54272,"magma":54528,"nether_wart_block":54784,"red_nether_brick":55040,"bone_block":55296,"item":55781,"item1":55782,"item2":55783,"item3":55784,"item4":55785,"item5":55786,"item6":55787,"item7":55788,"item8":55789,"item9":55790,"item10":55791,"item11":55792,"item12":55793,"item13":55794,"item14":55795,"item15":55796,"item16":55797,"item17":55798,"item18":55799,"item19":55800,"item20":55801,"item21":55802,"item22":55803,"item23":55804,"item24":55805,"item25":55806,"item26":55807,"observer":55808,"white_shulker_box":56064,"orange_shulker_box":56320,"magenta_shulker_box":56576,"light_blue_shulker_box":56832,"yellow_shulker_box":57088,"lime_shulker_box":57344,"pink_shulker_box":57600,"gray_shulker_box":57856,"light_gray_shulker_box":58112,"cyan_shulker_box":58368,"purple_shulker_box":58624,"blue_shulker_box":58880,"brown_shulker_box":59136,"green_shulker_box":59392,"red_shulker_box":59648,"black_shulker_box":59904,"white_glazed_terracotta":60160,"orange_glazed_terracotta":60416,"magenta_glazed_terracotta":60672,"light_blue_glazed_terracotta":60928,"yellow_glazed_terracotta":61184,"lime_glazed_terracotta":61440,"pink_glazed_terracotta":61696,"gray_glazed_terracotta":61952,"light_gray_glazed_terracotta":62208,"cyan_glazed_terracotta":62464,"purple_glazed_terracotta":62720,"blue_glazed_terracotta":62976,"brown_glazed_terracotta":63232,"green_glazed_terracotta":63488,"red_glazed_terracotta":63744,"black_glazed_terracotta":64000,"concrete":64256,"concrete1":64257,"concrete2":64258,"concrete3":64259,"concrete4":64260,"concrete5":64261,"concrete6":64262,"concrete7":64263,"concrete8":64264,"concrete9":64265,"concrete10":64266,"concrete11":64267,"concrete12":64268,"concrete13":64269,"concrete14":64270,"concrete15":64271,"concrete_powder":64512,"concrete_powder1":64513,"concrete_powder2":64514,"concrete_powder3":64515,"concrete_powder4":64516,"concrete_powder5":64517,"concrete_powder6":64518,"concrete_powder7":64519,"concrete_powder8":64520,"concrete_powder9":64521,"concrete_powder10":64522,"concrete_powder11":64523,"concrete_powder12":64524,"concrete_powder13":64525,"concrete_powder14":64527,"structure_block":65280}
//const itemblocks = {"item": 55781, "item1": 55782, "item2": 55783, "item3": 55784, "item4": 55785, "item5": 55786, "item6": 55787, "item7": 55788, "item8": 55789, "item9": 55790, "item10": 55791, "item11": 55792, "item12": 55793, "item13": 55794, "item14": 55795, "item15": 55796, "item16": 55797, "item17": 55798, "item18": 55799, "item19": 55800, "item20": 55801, "item21": 55802, "item22": 55803, "item23": 55804, "item24": 55805}
const itemblocks = {"item1": 55782, "item4": 55785, "item5": 55786, "item7": 55788, "item8": 55789, "item9": 55790, "item10": 55791, "item11": 55792, "item12": 55793, "item13": 55794, "item14": 55795, "item15": 55796, "item16": 55797, "item17": 55798, "item18": 55799, "item19": 55800, "item20": 55801, "item21": 55802, "item22": 55803, "item23": 55804, "item24": 55805}
const printblocks = {53248:"#5C473B",4864:"#B7963A",4355:"#AA806A",41472:"#995940",4353:"#6F4D4F",4352:"#91754A",4096:"#605B56",3840:"#746259",3584:"#8D6D44",3328:"#67635D",3073:"#AF756A",3072:"#C09B6D",2816:"#8A1315",1792:"#535259",1285:"#67473B",1284:"#9A5945",1283:"#BB896F",1282:"#C0AB7E",1281:"#694B53",1280:"#967750",1024:"#69655F",770:"#8D5D38",769:"#544436",768:"#554239",512:"#41672F",262:"#6C685F",261:"#66635A",260:"#B2AD9B",259:"#9E998C",258:"#8E725A",257:"#856554",256:"#898985",4865:"#887F39",5376:"#646274",5632:"#494CAD",5888:"#757068",6144:"#BA9368",6400:"#8B674C",7424:"#706643",8448:"#7A6249",8960:"#C2B6A6",8961:"#E2A35B",8962:"#D2666B",8963:"#5EB3C3",8964:"#E2CB5B",8965:"#94D25B",8966:"#CB87E9",8967:"#7D756C",8968:"#A79C8A",8969:"#5BBDA6",8970:"#AA73DB",8971:"#3D60C2",8972:"#724730",8973:"#2F9543",8974:"#AF3C39",8975:"#443A3A",12544:"#31263A",12288:"#4E6543",12032:"#876950",11777:"#A54433",11520:"#884E3D",11279:"#E7DFCD",11278:"#5B2938",11277:"#6C6962",11276:"#884E3D",11275:"#69655F",11274:"#967750",11273:"#BA9368",11272:"#757068",11271:"#E7DFCD",11270:"#5B2938",11269:"#6C6962",11268:"#884E3D",11267:"#69655F",46592:"#A86E66",11265:"#BA9368",11264:"#757068",11023:"#E7DDCC",11017:"#BA9368",11016:"#757068",11015:"#E7DFCD",11014:"#5B2938",11013:"#6C6962",11012:"#884E3D",11011:"#69655F",46336:"#A86E66",11009:"#BA9368",11008:"#898985",10752:"#DCD0CA",10496:"#EED442",14336:"#748482",14592:"#8FB6B9",14848:"#927450",15360:"#533F36",15616:"#747269",15872:"#747269",16384:"#866B4C",17152:"#67635D",18176:"#514A45",18688:"#735E56",19968:"#E7F3F1",20480:"#E7F3F1",20992:"#83665D",21504:"#4A3F35",22016:"#C35C2B",22272:"#63201B",22528:"#453E37",22784:"#AE9880",28672:"#5B2938",28160:"#57666A",27904:"#67635D",27648:"#67635D",26368:"#46611F",25600:"#93181D",25344:"#8A5B3B",25091:"#747269",25090:"#68645E",25089:"#4E6543",25088:"#6C6962",23296:"#C35C2B",29184:"#67635D",30976:"#90A895",31232:"#141212",32000:"#967750",32001:"#694B53",32002:"#C0AB7E",32003:"#BB896F",32004:"#9A5945",32005:"#67473B",32256:"#967750",32257:"#694B53",32258:"#C0AB7E",32259:"#BB896F",32260:"#9A5945",32261:"#67473B",32768:"#C09B6D",33024:"#858978",34048:"#0A7E38",34304:"#67635D",35072:"#A47F6C",35584:"#69655F",35585:"#576449",41473:"#995940",40719:"#3D3434",40718:"#A83636",40717:"#288C45",40716:"#6D402E",40715:"#3C52BC",40714:"#9969D2",40713:"#56B4A0",40712:"#BDB0A0",40711:"#716962",40710:"#AC9ECB",40709:"#86C954",40708:"#DDBF57",40707:"#58A7B9",40706:"#CA606B",40705:"#DD9757",40704:"#BDB0A0",40448:"#857F75",39936:"#E7DFCD",39681:"#D8CEBE",39680:"#E7DFCD",39168:"#672F29",38912:"#8F2C21",38144:"#8C7F74",41728:"#9A5945",41984:"#967750",43008:"#3B4244",43009:"#2D3233",43010:"#2E3435",43264:"#566B65",43520:"#D59B33",44032:"#A37456",44288:"#211F1F",44544:"#C1B1E4",45824:"#A86E66",55794:"#8647CD",55793:"#D18745",55792:"#979797",55791:"#4DAF4A",55790:"#0685D6",55789:"#8748D6",55788:"#D68B47",55787:"#A7A59F",55786:"#9B9B9B",55785:"#9B9790",55784:"#AAAAAA",55783:"#9A938E",55782:"#EC8642",55781:"#1DA6FE",55296:"#D0C3AE",55040:"#46332A",54784:"#5A1B18",54528:"#7C2B1D",54016:"#7F978D",52736:"#827060",51968:"#67635D",51712:"#3A3532",50432:"#2C2724",49920:"#866B4C",49664:"#866B4C",49408:"#866B4C",55795:"#0B81CD",55796:"#4BA844",55797:"#959291",55798:"#E1914B",55799:"#904DDC",55800:"#0A8CDC",55801:"#50B549",55802:"#A19E9C",55803:"#E79B55",55804:"#9556E8",55805:"#0F96E8",55806:"#5BC058",55807:"#898985",55808:"#797165",56064:"#857B6C",56320:"#754F2B",56576:"#443629",56832:"#656F71",57344:"#61692E",57600:"#7E684E",58368:"#636A3E",58624:"#34302E",58880:"#4D433D",59136:"#4D3E2E",59392:"#26341A",59648:"#742B23",59904:"#2B2521",60160:"#B2ADA7",60416:"#9F5530",60672:"#BD7892",60928:"#78A5B2",61184:"#D2B56A",61440:"#A3AD40",61696:"#E1A7A4",61952:"#5C5B56",62464:"#44716C",62720:"#644C6F",62976:"#254C5A",63232:"#413026",63488:"#6F8341",63744:"#663B30",64000:"#31201E",64527:"#1E1B1A",64525:"#913A37",64524:"#4E6339",64523:"#5D4839",64522:"#354D6D",64521:"#466765",64520:"#7A7167",64519:"#706B62",64518:"#AE7B91",64517:"#3E6830",64516:"#C09337",64515:"#416374",64514:"#744157",64513:"#C57733",64512:"#B7AFA0",64271:"#433939",64270:"#AF3B37",64269:"#2F9443",64268:"#724630",64267:"#3D5EC1",64266:"#A772D9",64265:"#5ABCA4",64264:"#A59A89",64263:"#7B736A",64262:"#C986E8",64261:"#93D15A",64260:"#E1C95A",64259:"#5DB1C1",64258:"#D1656B",64257:"#E1A15A",64256:"#C1B5A5"};
const blockStrings = Object.keys(blocks).slice(1);
let blockCommands = ['item', 'set', 'box', 'replace', 'sphere', 'hsphere'];
let commands = ['truecoords', 'ignore', 'unignore', 'unstuck', 'drain', 'item', 'invsize', 'tp', 'time', 'bg', '1', '2', 'pos1', 'pos2', 'stop', 'positions', 'set', 'box', 'replace', 'sphere', 'hsphere', 'copy', 'paste', 'clearclipboard', 'load', 'save', 'b', 'builds', 'new'];
let espGeometry, lineMaterial, red, espMaterial, textCanvas;
//add global
function addGlobal(name, value) {
var script = document.createElement('script');
script.textContent = `window.${name} = ${value};`;
(document.head||document.documentElement).appendChild(script);
script.remove();
}
function start() {
addGlobal('cheatnite', '{}');
cheatnite.auto = true;
cheatnite.coords = [0,0,0];
cheatnite.worldedit = {
clipboard: [null, null, {}],
builds: {}
};
cheatnite.ignored = [];
cheatnite.customBlockId = 256;
cheatnite.server = {};
cheatnite.fly = false;
cheatnite.chatspam = null;
cheatnite.chatspam_count = 0;
cheatnite.bulletspam = null;
cheatnite.tntspam = null;
cheatnite.bedrock = false;
cheatnite.drain = false;
cheatnite.esp = true;
cheatnite.noclip = false;
cheatnite.invisible = false;
cheatnite.darkMode = false;
cheatnite.shiftKeyPressed = false;
document.getElementById("leftwrap").innerHTML = "";
// Cheat display configuration (inspired by some hacked client code)
cheatnite.cheatDisp = document.createElement("h1");
cheatnite.cheatDisp.style.position = "fixed";
cheatnite.cheatDisp.style.fontSize = "156.25%";
cheatnite.cheatDisp.style.right = 0;
cheatnite.cheatDisp.style.marginRight = "10px";
cheatnite.cheatDisp.style.backgroundColor = "rgba(0, 0, 0, 0)";
cheatnite.cheatDisp.style.textAlign = "right";
cheatnite.cheatDisp.style.fontFamily = "'Lucida Console', Monaco, monospace";
cheatnite.cheatDisp.style.fontWeight = "bold";
document.body.appendChild(cheatnite.cheatDisp);
cheatnite.activatedCheats = ['ESP'];
cheatnite.updateCheatDisp = true;
// If necessary, allow a brief delay for GAME to be fully set up before applying the texture
}
window.addEventListener('load', start);
/*
CUSTOM STYLES
*/
GM_addStyle(`
input#customServer {
height: 63px;
width: 100%;
text-align: center;
font-size: 22px;
font-family: Madera;
color: #000 !important;
border: 0px solid #000000;
background: #ffffff;
border-radius: 2px;
}
`);
/*
CUSTOM SERVER
*/
function addInputAbovePlayButton() {
// Find the play button element
const playBtn = document.getElementById('playbtn');
// Create a new input element
const customServer = document.createElement('input');
customServer.id = 'customServer';
customServer.type = 'text';
customServer.placeholder = 'Random server';
customServer.value = localStorage.getItem('lastServer') ? localStorage.getItem('lastServer') : '';
// Insert the new input element before the play button element
// playBtn.parentNode.insertBefore(customServer, playBtn);
// Add a line break before the custom input
const lineBreak = document.createElement('br');
customServer.parentNode.insertBefore(lineBreak, customServer);
}
// Wait for the page to load and then execute the function
window.addEventListener('load', addInputAbovePlayButton);
function addCustomServerInputAndTexturePackSelector() {
// Find necessary elements
var playBtn = document.getElementById('playbtn');
var rightwrap = document.getElementById("rightwrap");
// Check if elements exist and play button is not disabled
if (playBtn && !playBtn.disabled) {
// Hide the element to the right
if (rightwrap) {
rightwrap.style.display = "none";
}
// Create and insert the custom server input
var customServerInput = document.createElement('input');
customServerInput.id = 'customServer';
customServerInput.type = 'text';
customServerInput.placeholder = 'Random server';
customServerInput.value = localStorage.getItem('lastServer') || '';
playBtn.parentNode.insertBefore(customServerInput, playBtn);
// Apply styles to the custom server input
applyCustomStyles(customServerInput);
// Create a line break for spacing
var lineBreak1 = document.createElement('br');
customServerInput.parentNode.insertBefore(lineBreak1, customServerInput);
// Create the texture pack selector (dropdown)
var texturePackSelector = document.createElement('select');
texturePackSelector.id = 'texturePackSelector';
// Create default option
var defaultOption = document.createElement('option');
defaultOption.value = '';
defaultOption.textContent = 'Select Texture Pack';
texturePackSelector.appendChild(defaultOption);
// Array of texture pack options
var texturePacks = [
{ name: 'Default', src: 'https://craftnite.io/world-texture/chilvary.png' },
{ name: 'Matrix', src: 'https://i.imgur.com/RSUidhY.png' },
{ name: 'Minecraft', src: 'https://i.imgur.com/lfEUSyS.png' },
{ name: 'Lucky BLock', src: 'https://i.imgur.com/blTbuwg.png' },
{ name: '???', src: 'https://i.imgur.com/CUaGjTa.png' },
{ name: 'Retro', src: 'https://i.imgur.com/HL7o34O.png' },
{ name: 'LowRes', src: 'https://i.imgur.com/tZX6C08.png' },
{ name: 'Solid', src: 'https://i.imgur.com/SFWvYz2.png' },
{ name: 'Addiction', src: 'https://i.imgur.com/ZCNGAKr.png' },
{ name: 'Dopamine', src: 'https://i.imgur.com/RRc6LVd.png' },
{ name: 'Glamorous', src: 'https://i.imgur.com/EwhelXN.png' },
{ name: 'Superfuture', src: 'https://i.imgur.com/KnXcQ0W.png' },
{ name: 'Cyber', src: 'https://i.imgur.com/LSFElxj.png' },
{ name: 'Smoother', src: 'https://i.imgur.com/oPPjpsd.png' },
{ name: 'Narcotics', src: 'https://i.imgur.com/yVxXg3K.png' },
{ name: 'Corruption', src: 'https://i.imgur.com/9jDXbfW.png' },
{ name: 'Corruption Nuevo', src: 'https://i.imgur.com/VZrr1n7.png' },
{ name: 'Retro 2', src: 'https://i.imgur.com/sBUzJji.png' },
{ name: 'Brutal Dither', src: 'https://i.imgur.com/DyfQAVR.png' },
{ name: 'BloodBath', src: 'https://i.imgur.com/W4dYooc.png' },
{ name: 'Shuffle', src: 'https://i.imgur.com/ri5cmAa.png' },
{ name: 'Wonderland', src: 'https://i.imgur.com/Z5ykCQF.png' },
{ name: 'Snow Time', src: 'https://i.imgur.com/XtgYgBg.png' },
// Add more texture packs as needed
];
// Populate the dropdown with texture pack options
texturePacks.forEach(function(pack) {
var option = document.createElement('option');
option.value = pack.src;
option.textContent = pack.name;
texturePackSelector.appendChild(option);
});
// Insert the texture pack selector above the custom server input
customServerInput.parentNode.insertBefore(texturePackSelector, lineBreak1);
// Apply styles to the texture pack selector
applyCustomStyles(texturePackSelector);
// Event listener for texture pack selection
texturePackSelector.addEventListener('change', function() {
var selectedTexturePack = texturePackSelector.value;
if (selectedTexturePack) {
selectTexturePack(selectedTexturePack);
}
});
// Function to handle texture pack selection
function selectTexturePack(src) {
localStorage.setItem('selectedTexturePack', src);
// Handle the texture pack loading as needed
console.log(`Selected Texture Pack: ${src}`);
}
}
// Function to apply custom styles
function applyCustomStyles(element) {
element.style.height = "63px";
element.style.width = "100%";
element.style.textAlign = "center";
element.style.fontSize = "15px";
element.style.fontFamily = "Minecraftia";
element.style.color = "#ffffff";
element.style.background = "#5e5e5e";
element.style.textShadow = "rgba(0, 0, 0, 0.667) 2px 2px";
element.style.boxShadow = "rgba(0, 0, 0, 0.267) 2px 4px inset, rgba(255, 255, 255, 0.333) -2px -2px inset";
element.style.margin = "10px 0px 0px 0px";
}
}
// Wait for the page to load and then execute the function
window.addEventListener('load', addCustomServerInputAndTexturePackSelector);
// Custom start game function
function customStartBtn () {
let nameValue = document.getElementById ('name').value;
addGlobal('playerName', nameValue ? JSON.stringify(nameValue) : JSON.stringify('unnamed'))
setCookie ("name", playerName, 365);
setCookie ("skin", playerSkin, 365);
var inputValue = (document.getElementById('customServer').value || '').trim();
var localStorageValue = localStorage.getItem('lastServer');
if (inputValue === 'Random server' || !inputValue) {
requestServerName();
} else if (localStorageValue && inputValue === 'Last server') {
localStorage.setItem('lastServer', localStorageValue);
G.gameServerAddress = localStorageValue;
playGame();
} else {
localStorage.setItem('lastServer', inputValue);
G.gameServerAddress = inputValue;
playGame();
}
}
function loadSelectedWorldTexture() {
var selectedTexture = localStorage.getItem('selectedTexturePack');
if (selectedTexture && isURL(selectedTexture)) {
addCustomChat('<', 'Loading world texture from selected pack...');
const textureLoader = new THREE.TextureLoader();
textureLoader.load(selectedTexture, (texture) => {
// Set texture filters as in your original loadWorldTexture
texture.magFilter = THREE.NearestFilter;
texture.minFilter = THREE.NearestMipmapLinearFilter;
// Apply the texture to the game uniforms and assets
GAME.uniforms.texture1.value = texture;
GAME.assets[GAME.a836.Material].a643SolidMaterial.needsUpdate = true;
GAME.assets[GAME.a836.Material].a643TransparentMaterial.needsUpdate = true;
texture.needsUpdate = true;
addCustomChat('<', 'World texture set!');
});
} else {
console.log('No valid texture pack selected or not a URL.');
}
}
// Override the xml request
var originalSend = window.XMLHttpRequest.prototype.send;
var originalOpen = window.XMLHttpRequest.prototype.open;
window.XMLHttpRequest.prototype.open = function(method, url) {
this._url = url;
return originalOpen.apply(this, arguments);
};
window.XMLHttpRequest.prototype.send = function() {
if (this._url && this._url.startsWith('https://craftnite.io/gs/requestServer.php')){
this.addEventListener('readystatechange', function() {
if (this.readyState === 4) {
var inputValue = (document.getElementById('customServer')?.value || '').trim();
var localStorageValue = localStorage.getItem('lastServer');
if (inputValue === 'Random server' || !inputValue) {
localStorage.setItem('lastServer', this.responseText);
return this.responseText
}
}
}, false);
}
//+ adblock
if (this._url.startsWith('https://craftnite.io') || this._url === 'a.zip') {
return originalSend.apply(this, arguments);c
}
};
/*
CHAT CMD AUTOCOMPLETE
*/
let selectedIndex = -1;
let suggestions = [];
function chatCmdSuggestions(event) {
let keyCode = event.keyCode;
if (keyCode !== 40 && keyCode !== 38 && keyCode !== 13) {
let filter = GAME.chatInput.value.toLowerCase();
// Clear suggestions array
suggestions = [];
// Check if filter includes slash
if (filter.includes('/')) {
// Check if filter includes blockCommands (e.g., '/set')
let command = blockCommands.find(command => filter.startsWith('/' + command.toLowerCase() + ' '));
if (command) {
filter = filter.slice(command.length + 1).trim();
Object.keys(blocks).forEach(item => {
if (item.toLowerCase().includes(filter)) {
suggestions.push('/' + command + ' ' + item);
}
});
} else {
commands.forEach(command => {
if (command.toLowerCase().startsWith(filter.slice(1))) {
suggestions.push('/' + command);
}
});
}
}
}
// Handle arrow keys and Enter
if (keyCode === 40 || keyCode === 38 || keyCode === 13) {
if (selectedIndex >= 0) {
if (keyCode === 13) { // Enter key
GAME.chatInput.value = suggestions[selectedIndex] || GAME.chatInput.value;
selectedIndex = -1;
GAME.chatInput.focus();
return;
}
}
if (keyCode === 40) { // Arrow down
selectedIndex++;
if (selectedIndex >= suggestions.length) {
selectedIndex = 0;
}
} else if (keyCode === 38) { // Arrow up
selectedIndex--;
if (selectedIndex < 0) {
selectedIndex = suggestions.length - 1;
}
}
GAME.chatInput.value = suggestions[selectedIndex] || GAME.chatInput.value;
}
}
/*
HELPER/UTILS FUNCS
*/
// Fisher-Yates shuffle algorithm
function shuffle(array) {
for (let i = array.length - 1; i > 0; i--) {
const j = Math.floor(Math.random() * (i + 1));
[array[i], array[j]] = [array[j], array[i]];
}
}
async function a637(positions, blockIds, errorCallback=null) {
const indices = Array.from({length: positions.length}, (_, n) => n);
//shuffle(indices);
var index, chunkCoords, chunk, innerPos, pkt;
for (var r = 0; r < indices.length; r++) {
if (!cheatnite.worldedit.inprogress) {
if (errorCallback)
errorCallback();
return;
}
index = indices[r];
chunkCoords = GAME.a865.getChunkFromPos(positions[index]);
innerPos = coordsToInsidePos(positions[index], chunkCoords);
pkt = new a234();
pkt.i = chunkCoords[0];
pkt.e = chunkCoords[1];
pkt.o = chunkCoords[2];
pkt.v = innerPos;
pkt.u = blockIds[index];
G.socket.send(pkt.a614());
if (r % 9 === 8) {
await sleep(cheatnite.server.r*250);
}
}
}
async function rawa637(iArr, eArr, oArr, vArr, uArr, errorCallback=null) {
const indices = Array.from({length: iArr.length}, (_, n) => n);
//shuffle(indices);
var index, pkt;
for (var r = 0; r < indices.length; r++) {
if (!cheatnite.worldedit.inprogress) {
if (errorCallback)
errorCallback();
return;
}
index = indices[r];
pkt = new a234();
pkt.i = iArr[index];
pkt.e = eArr[index];
pkt.o = oArr[index];
pkt.v = vArr[index];
pkt.u = uArr[index];
G.socket.send(pkt.a614());
if (r % 9 === 8) {
await sleep(cheatnite.server.r*250);
}
}
}
function tp(pos, updateVisual = true) {
let me = GAME.a865.player;
var pkt = new a175();
pkt.time = parseFloat(("" + Date.now() / 1e3).slice(4));
pkt.x = pos.x;
pkt.y = pos.y;
pkt.z = pos.z;
pkt.a751 = me.a751;
if (updateVisual) {
me.controls.moveCameraTo(pos);
me.position.copy(pos);
}
if (me.camera != null) {
me.camera.rotation.order = "YXZ";
pkt.a748 = me.camera.rotation.y;
pkt.a749 = me.camera.rotation.x;
}
G.socket.send(pkt.a614())
}
function getColor(index, total) {
let hue = 360 * (index / (total * 2));
let saturation = 100;
let lightness = 75;
return `hsl(${hue}, ${saturation}%, ${lightness}%)`;
}
function randomIP() {
const octets = [];
for (let i = 0; i < 4; i++) {
const octet = Math.floor(Math.random() * 256);
octets.push(octet);
}
return octets.join('.');
}
function isURL(str) {
try {
new URL(str);
return true;
} catch (e) {
return false;
}
}
function getBuildName(filename) {
if (filename === '') {
filename = '';
}
filename = filename.replaceAll(' ', '_');
while (Object.keys(cheatnite.worldedit.builds).includes(filename)) {
if (/\d+$/.test(filename)) {
filename = filename.replace(/(\d+)$/, (match) => parseInt(match) + 1);
} else {
filename = filename + '1';
}
}
return filename;
}
//shoot
function shoot(gun) {
var e = new THREE.Vector3;
var a = 8;
var b = 9;
switch (gun) {
case "pistol":
a = 8;
b = 9;
break;
case "shotgun":
a = 12;
b = 13;
var spread = 0.06; //spread goes from 0.03 - 0.06
for (var i = 0; i < 8; i++) {
e.x = G.randFloat(-spread, spread, 2);
e.y = G.randFloat(-spread, spread, 2);
e.z = G.randFloat(-spread, spread, 2);
GAME.a865.player.a609(a, b, {
headshotMsg: ["boom ", "headshot"],
headshotColor: ["rgba(255,0,0,{opacity})", "rgba(255,255,255,{opacity})"]
}, false, false, e)
}
return;
case "sniper":
a = 16;
b = 17;
e.x *= 100;
e.y = G.randFloat(20 * -GAME.a865.player.a92.y, 20 * GAME.a865.player.a92.y, 2);
e.z *= 100;
break;
case "ak47":
a = 14;
b = 15;
e.x *= 100;
e.y = G.randFloat(-GAME.a865.player.a92.y / 2, GAME.a865.player.a92.y / 2, 2);
e.z *= 100;
break;
}
GAME.a865.player.a609(a, b, {
headshotMsg: ["boom ", "headshot"],
headshotColor: ["rgba(255,0,0,{opacity})", "rgba(255,255,255,{opacity})"]
}, false, false, e)
}
function throwItem(item) {
var e = new THREE.Vector3;
var spread = 0.2
e.x = G.randFloat(-spread, spread, 2);
e.y = G.randFloat(-spread, spread, 2);
e.z = G.randFloat(-spread, spread, 2);
switch(item) {
case "stone":
GAME.a865.player.a609(2, 2, {
me: true
});
break;
case "wood":
GAME.a865.player.a609(3, 3, {
me: true
});
break;
case "tnt":
GAME.a865.player.a609(4, 4, {
me: true
}, false, false, e);
break;
case "stairs":
GAME.a865.player.a609(6, 6, {
me: true
})
}
}
function onDeath(dv) {
//GAME.a865.player.respawn();
let c = new a191();
c.a615(dv);
GAME.a865.player.a539();
GAME.addKillfeed(G.othera822ers[c.a163].name, "killed", GAME.a865.player.name);
GAME.myKillerId = c.a163;
G.othera822ers[c.a163] && G.othera822ers[c.a163].a472.add(GAME.camera);
GAME.drawLeaderboard();
$(document).off("mousedown.pointerLock");
GAME.respawnIn = 0;
$(document).on("mousedown.respawn", (function(t) {
if(!$(t.target).is("#bottomright")) {
GAME.a865.player.respawn();
GAME.a865.player.controls.lock();
$(document).off("mousedown.respawn");
}
}))
GAME.uiManager.inventory.close();
GAME.deadPopup = true;
cheatnite.customBlockId = 256;
if (cheatnite.tntspam) {
cheatnite.tntspam = null;
clearInterval(cheatnite.tntspam);
modifyCheatDisp("tntspam");
}
if (cheatnite.bulletspam) {
clearInterval(cheatnite.bulletspam);
cheatnite.bulletspam = null;
modifyCheatDisp("bulletspam");
}
if (cheatnite.autorespawn) {
clearInterval(cheatnite.autorespawn);
cheatnite.autorespawn = null;
modifyCheatDisp("autorespawn");
}
cheatnite.updateCheatDisp = true;
}
function parseOutgoingChat(dv) {
let msg = "";
for (let i = 1; i < dv.byteLength; i += 2) {
const charCode = dv.getUint16(i, true);
msg += String.fromCharCode(charCode);
}
return msg;
}
//modified drawLeaderboard func to include ID in lb data
function drawLeaderboard() {
GAME.leaderboard = [];
for (var t = [], e = 0; e < 120; e++)
if (G.othera822ers[e]) {
var i = G.othera822ers[e];
t.push([i.a649, i.id, i.name])
}
t.sort((function(t, e) {
return t[0] - e[0]
}
));
for (var o = -1, n = 0, s = !1, r = !1, a = !1, h = (e = 0,
0), l = t.length - 1; l >= 0; l--)
a = t[l][1] == GAME.a865.player.id,
t[l][0] != o && (o = t[l][0],
n++),
r = !1,
e < 10 ? (a && (s = !0),
r = !0) : s ? 10 == e && (r = !0) : a && (r = !0),
r && (GAME.leaderboard[h] = {
me: a,
rank: n,
name: `(${t[l][1]}) ${t[l][2]}`,
a649: t[l][0],
id: t[l][1]
},
h++),
e++
}
function addCustomChat(name, msg) {
if ("" != (msg = msg.trim())) {
GAME.chat.push({
name: name,
msg: msg
});
if (GAME.chat.length > 5)
GAME.chat = GAME.chat.slice(GAME.chat.length - 5, GAME.chat.length);
GAME.newChatMessage = true;
}
}
function addChat(t, e) {
if ("" != (e = e.trim())) {
if (cheatnite.ignored.includes(G.othera822ers[t].id)) {
return;
}
var i = "server";
255 != t && (i = G.othera822ers[t].name);
if (i > 20) {
i = i.substring(0, 17) + '...';
}
var name = `(${G.othera822ers[t].id}) ` + i;
GAME.chat.push({
name: name,
msg: e
});
if (GAME.chat.length > 5)
GAME.chat = GAME.chat.slice(GAME.chat.length - 5, GAME.chat.length);
GAME.newChatMessage = true;
}
}
function sleep(milliseconds) {
return new Promise(resolve => setTimeout(resolve, milliseconds));
}
function checkInt(num) {
return !isNaN(parseInt(num));
}
function checkNumsInArr(arr, len) {
var nums = [];
for (let i in arr) {
if (!isNaN(Number(arr[i]))) {
nums.push(Number(arr[i]));
}
}
if (nums.length === len) {
return nums;
}
return false;
}
function convertCoords(coords, type) {
if (!coords) {
return false;
}
var convertedCoords = new THREE.Vector3();
if(type === "adjusted") {
// Convert from true coords to adjusted coords
convertedCoords.x = coords.x / 5 - 740;
convertedCoords.y = coords.y / 5 - 53;
convertedCoords.z = coords.z / 5 - 550;
} else if(type === "true") {
// Convert from adjusted coords to true coords
convertedCoords.x = (coords.x + 740) * 5;
convertedCoords.y = (coords.y + 53) * 5;
convertedCoords.z = (coords.z + 550) * 5;
} else {
throw new Error('convertCoords type must be "true" or "adjusted".');
}
return convertedCoords;
}
function showKillFeed() {
GAME.killfeedCanvas.cvs.clear();
const num = (GAME.killfeed.length < 5) ? 0 : (GAME.killfeed.length - 5);
for (let i = 0, index = num; index < GAME.killfeed.length; index++) {
const entry = GAME.killfeed[index];
if (entry) {
const killer = (entry.killer.length < 10) ? entry.killer : (entry.killer.substring(0, 10) + "..");
const victim = (entry.victim.length < 10) ? entry.victim : (entry.victim.substring(0, 10) + "..");
const killFeedText = `${killer} ${entry.action} ${victim}`;
GAME.killfeedCanvas.text(
[10, 4 + 24 * i],
[0, 0],
killFeedText,
"rgba(255, 255, 255, .9)",
20,
"top",
"left",
G.a816
);
i++;
}
}
GAME.killfeedCanvas.cvs.flip();
GAME.killfeedCanvas.cvs.show();
}
function modifyCheatDisp(text) {
const index = cheatnite.activatedCheats.indexOf(text);
if (index !== -1) {
cheatnite.activatedCheats.splice(index, 1);
} else {
cheatnite.activatedCheats.push(text);
}
cheatnite.updateCheatDisp = true;
}
function customPosToV(t, buildP) {
for (var e = -1, i = 0; i < 32; i++)
if (t.x >= buildP.x + 5*i && t.x <= buildP.x + 5*(i + 1)) {
e = i;
break
}
var o = -1;
for (i = 0; i < 32; i++)
if (t.y >= buildP.y + 5*i && t.y <= buildP.y + 5*(i + 1)) {
o = i;
break
}
var n = -1;
for (i = 0; i < 32; i++)
if (t.z >= buildP.z + 5*i && t.z <= buildP.z + 5*(i + 1)) {
n = i;
break
}
return -1 != e && -1 != o && -1 != n && G.a650.prototype.a720(e, o, n)
}
function posTochunk(pos, buildP = null) {
const chunkCoords = GAME.a865.getChunkFromPos(pos);
const [i, e, o] = chunkCoords;
let insidePos;
if (buildP) {
insidePos = customPosToV(pos, GAME.a865.a643s[i][e][o].buildP.clone());
} else {
insidePos = GAME.a865.a643s[i][e][o]?.posToV(pos);
}
return [chunkCoords, insidePos];
}
function getBlockIdAtPos(pos, buildP = null) {
// convert world position to chunk coordinates
const chunkCoords = GAME.a865.getChunkFromPos(pos);
const [i, e, o] = chunkCoords;
if (i>160 || e>160 || o>160)
return null;
// get the corresponding chunk
const chunk = GAME.a865.a643s?.[i]?.[e]?.[o];
if (!chunk) {
return 0; //air, cause turns out empty chunks are...null
}
try {
// convert world position to inside position within the chunk
let insidePos;
if (buildP) {
insidePos = customPosToV(pos, chunk.buildP.clone());
} else {
insidePos = chunk.posToV(pos);
}
// get the block ID from the chunk's volume array
const blockId = chunk.volume[insidePos];
return blockId;
} catch {
return null;
}
}
function getLookAtBlockId() {
let blockId = null;
var position = GAME.a865.player.position;
position.y += 2.5;
var rotation = GAME.a865.player.direction;
const lookDirection = new THREE.Vector3();
lookDirection.setFromSphericalCoords(rotation.x, rotation.y, rotation.z);
const maxDistance = 1000;
const stepSize = 0.1;
const lookPosition = new THREE.Vector3();
for (let distance = 0; distance <= maxDistance; distance += stepSize) {
lookPosition.copy(position).addScaledVector(rotation, distance);
blockId = getBlockIdAtPos(lookPosition);
if (blockId) {
break;
}
}
return blockId;
}
function wasThrown() {
try {
throw new Error();
} catch (e) {
const stackLines = e.stack.split('\n');
const callerLine = stackLines[3];
const functionName = callerLine.match(/\ba853\b/);
return !!functionName;
}
}
function countItemInInv(target) {
let count = 0;
for (const item of GAME.a865.player.items) {
if (item !== -1 && item.a474Id === target && item.total) {
count += item.total;
}
}
return count;
}
function getFormattedDateString() {
const date = new Date();
const year = date.getFullYear();
const month = String(date.getMonth() + 1).padStart(2, '0');
const day = String(date.getDate()).padStart(2, '0');
const hours = String(date.getHours()).padStart(2, '0');
const minutes = String(date.getMinutes()).padStart(2, '0');
const seconds = String(date.getSeconds()).padStart(2, '0');
return `${year}-${month}-${day}-${hours}-${minutes}-${seconds}`;
}
function saveScene() {
var renderer = GAME.renderer;
var camera = GAME.a865.player.camera;
renderer.render(GAME.scene, camera);
var link = document.createElement('a');
link.href = renderer.domElement.toDataURL('image/png');
link.download = 'craftnite-io-'+getFormattedDateString()+'.png';
link.style.display = 'none';
document.body.appendChild(link);
link.click();
document.body.removeChild(link);
}
function hidePlayerBoxes() {
const players = [];
for (const p of G.othera822ers)
if (p && p.id !== GAME.a865.player.id)
players.push(p);
for (let i = 0; i < players.length; i++) {
const player = players[i];
if (player.a472.box) {
player.a472.box.visible = false;
}
}
}
function showPlayerBoxes() {
const players = [];
for (const p of G.othera822ers)
if (p && p.id !== GAME.a865.player.id)
players.push(p);
for (let i = 0; i < players.length; i++) {
const player = players[i];
if (player.a472.box) {
player.a472.box.visible = true;
}
}
}
async function handleImageCommand(args) {
if (args.length !== 2) {
return WorldEdit.error('Usage: /img <plane1> <plane2> (e.g., x y, -x z, y -z)');
}
const plane1 = args[0].toLowerCase();
const plane2 = args[1].toLowerCase();
const validPlanes = ['x', '-x', 'y', '-y', 'z', '-z'];
if (!validPlanes.includes(plane1) || !validPlanes.includes(plane2) || plane1[plane1.length - 1] === plane2[plane2.length - 1]) {
return WorldEdit.error('Invalid plane arguments. Use combinations of x, -x, y, -y, z, -z');
}
// Create file input
const input = document.createElement('input');
input.type = 'file';
input.accept = 'image/*';
input.onchange = async (event) => {
try {
const file = event.target.files[0];
const image = await createImageBitmap(file);
const buildName = getBuildName(file.name.split('.')[0]);
const canvas = document.createElement('canvas');
const ctx = canvas.getContext('2d');
canvas.width = image.width;
canvas.height = image.height;
ctx.drawImage(image, 0, 0);
const imageData = ctx.getImageData(0, 0, canvas.width, canvas.height);
const build = processImageData(imageData, plane1, plane2);
cheatnite.worldedit.builds[buildName] = build;
addCustomChat('WorldEdit', `Loaded image as build ${buildName} on ${plane1}${plane2} plane.`);
} catch (error) {
WorldEdit.error(error.toString());
} finally {
input.remove();
}
};
input.click();
}
function processImageData(imageData, plane1, plane2) {
const build = [];
const { width, height, data } = imageData;
for (let y = 0; y < height; y++) {
for (let x = 0; x < width; x++) {
const index = (y * width + x) * 4;
const r = data[index];
const g = data[index + 1];
const b = data[index + 2];
const a = data[index + 3]; // Alpha channel
// Skip transparent pixels
if (a === 0) continue;
const hexColor = rgbToHex(r, g, b);
const blockId = findClosestBlockId(hexColor);
if (blockId !== null) {
const blockName = Object.keys(blocks).find(key => blocks[key] === blockId);
const pos = getPosition(x, y, width, height, plane1, plane2);
build.push({ name: blockName, pos });
}
}
}
return build;
}
function rgbToHex(r, g, b) {
return `#${((1 << 24) + (r << 16) + (g << 8) + b).toString(16).slice(1).toUpperCase()}`;
}
function findClosestBlockId(hexColor) {
let closestColor = null;
let minDistance = Infinity;
for (const [blockId, color] of Object.entries(printblocks)) {
const distance = colorDistance(hexColor, color);
if (distance < minDistance) {
minDistance = distance;
closestColor = blockId;
}
}
return closestColor ? parseInt(closestColor) : null;
}
function colorDistance(hex1, hex2) {
const rgb1 = hexToRgb(hex1);
const rgb2 = hexToRgb(hex2);
return Math.sqrt(
Math.pow(rgb1.r - rgb2.r, 2) +
Math.pow(rgb1.g - rgb2.g, 2) +
Math.pow(rgb1.b - rgb2.b, 2)
);
}
function hexToRgb(hex) {
const bigint = parseInt(hex.slice(1), 16);
return {
r: (bigint >> 16) & 255,
g: (bigint >> 8) & 255,
b: bigint & 255
};
}
function getPosition(x, y, width, height, plane1, plane2) {
const pos = { x: 0, y: 0, z: 0 };
// Flip y-axis to start from bottom
y = height - y - 1;
// Define the mapping from image coordinates to axes
const planes = [plane1, plane2];
const imageCoordinates = [x, y];
// Keep track of which axes have been used
const axesUsed = [];
for (let i = 0; i < 2; i++) {
const plane = planes[i];
const value = imageCoordinates[i];
// Determine the axis ('x', 'y', or 'z')
const axis = plane.endsWith('x') ? 'x' :
plane.endsWith('y') ? 'y' : 'z';
axesUsed.push(axis);
// Determine the size for the axis (width or height)
const size = (i === 0) ? width - 1 : height - 1;
// Assign position, accounting for negative axes
if (plane.startsWith('-')) {
pos[axis] = size - value;
} else {
pos[axis] = value;
}
}
// Set the remaining axis to 0
const remainingAxis = ['x', 'y', 'z'].find(axis => !axesUsed.includes(axis));
pos[remainingAxis] = 0;
// Return position as an array [x, y, z]
return [pos.x, pos.y, pos.z];
}
// Existing key event listener
document.addEventListener('keydown', (event) => {
if (typeof(cheatnite) !== 'undefined' && document.activeElement && document.activeElement.tagName !== 'INPUT' && event.key === 'c' && !event.metaKey && !event.ctrlKey) {
const { blockId } = getLookAtBlockId();
cheatnite.customBlockId = blockId;
cheatnite.updateCheatDisp = true;
if (!cheatnite.customBlockId) {
addCustomChat('<', 'Reset stone items.');
return;
}
var stoneNeeded = 1000 - countItemInInv("stone");
if (stoneNeeded > 0) {
GAME.a865.player.a458("stone", stoneNeeded);
}
// Find the block name for the customBlockId
const blockEntry = Object.entries(blocks).find(([name, id]) => id === cheatnite.customBlockId);
const blockName = blockEntry ? blockEntry[0] : 'Unknown';
addCustomChat('<', `Thrown stone set to ${blockName} (ID: ${blockId}).`);
}
});
function flipObjectUpsideDown(points) {
let flippedPoints = [];
// find the minimum and maximum y-values of the object points
let minY = points[0].y;
let maxY = points[0].y;
for (let i = 1; i < points.length; i++) {
minY = Math.min(minY, points[i].y);
maxY = Math.max(maxY, points[i].y);
}
// calculate the range of the y-values
const yRange = maxY - minY;
// map each point's y-value to a new y-value that reflects the flipped position
for (let i = 0; i < points.length; i++) {
let point = points[i];
let newY = minY + (yRange - (point.y - minY));
flippedPoints.push(new THREE.Vector3(point.x, newY, point.z));
}
return flippedPoints;
}
//for saving clipboard or chunked builds
const cbReplacer = (key, value) => {
if (value && value.isVector3) {
return [value.x, value.y, value.z];
} else if (value instanceof Uint16Array) {
return Array.from(value);
}
return value;
};
//for parsing clipboard or chunked builds JSON
const cbReviver = (key, value) => {
if (Array.isArray(value)) {
if (value.length === 3 && value.every(i => typeof i === 'number')) {
return new THREE.Vector3(value[0], value[1], value[2]);
}
}
return value;
};
function readChunksFromLocal(file) {
return new Promise((resolve, reject) => {
const reader = new FileReader();
reader.onload = async (event) => {
if (file.name.endsWith('.json')) {
try {
const jsonData = JSON.parse(event.target.result, cbReviver);
if (jsonData.length !== 3) {
throw new Error('Incorrect length for chunks loaded from file. Expected 3, got '+jsonData.length.toString()+'.');
}
if (!jsonData[0].isVector3 || !jsonData[1].isVector3) {
throw new Error('First 2 items were expected to be arrays of length 3.');
}
if (Object.keys(jsonData[2]).some(key => typeof key !== 'string')) {
throw new Error('Expected all keys in 3rd item to be strings.');
}
resolve(jsonData);
} catch (error) {
reject(`Error parsing JSON file: ${error.message}`);
}
}
};
reader.onerror = (event) => {
reject(event.target.error);
};
reader.readAsText(file);
});
}
function readBuildFromLocal(file) {
return new Promise((resolve, reject) => {
const reader = new FileReader();
reader.onload = async (event) => {
const buffer = new Uint8Array(event.target.result);
const blks = await readBuildFile(file.name, buffer, blockStrings);
resolve(blks);
};
reader.onerror = (event) => {
reject(event.target.error);
};
reader.readAsArrayBuffer(file);
});
}
async function readBuildFromURL(url) {
const response = await fetch(url);
const buffer = new Uint8Array(await response.arrayBuffer());
const blks = await readBuildFile(url, buffer, blockStrings);
return blks;
}
function chunkToCoords(chunkCoords, insidePos) {
const [chunkX, chunkY, chunkZ] = chunkCoords;
const x = insidePos % 32;
const y = Math.floor(insidePos / 32) % 32;
const z = Math.floor(insidePos / (32 * 32));
const worldX = chunkX * 32 + x;
const worldY = chunkY * 32 + y;
const worldZ = chunkZ * 32 + z;
return new THREE.Vector3(5*worldX, 5*worldY, 5*worldZ);
}
function coordsToInsidePos(worldCoords, chunkCoords) {
const [chunkX, chunkY, chunkZ] = chunkCoords;
const x = Math.floor(worldCoords.x/5) - chunkX * 32;
const y = Math.floor(worldCoords.y/5) - chunkY * 32;
const z = Math.floor(worldCoords.z/5) - chunkZ * 32;
const insidePos = x + y * 32 + z * 32 * 32;
return insidePos;
}
/*
WORLDEDIT
*/
let WorldEdit = {};
//add check for water if y <= 317
//pos1 and pos2
WorldEdit.pos1 = function(args) {
let me = GAME.a865.player;
if (args.length === 0) {
cheatnite.worldedit.pos1 = me.position.clone();
addCustomChat('WorldEdit', `pos1 set to ${convertCoords(cheatnite.worldedit.pos1, "adjusted")}`)
} else if (args.length === 3) {
let nums = checkNumsInArr(args, 3)
if (!nums) {
this.error('Numbers expected as arguments.');
return;
}
let unadjusted = new THREE.Vector3(nums[0], nums[1], nums[2]);
cheatnite.worldedit.pos1 = convertCoords(unadjusted, "true");
addCustomChat('WorldEdit', `pos1 set to ${convertCoords(cheatnite.worldedit.pos1, "adjusted")}`)
} else {
this.error(`Expected 0 or 3 arguments, got ${args.length}.`);
}
return;
}
WorldEdit.pos2 = function(args) {
let me = GAME.a865.player;
if (args.length === 0) {
cheatnite.worldedit.pos2 = me.position.clone();
addCustomChat('WorldEdit', `pos2 set to ${convertCoords(cheatnite.worldedit.pos2, "adjusted")}`)
} else if (args.length === 3) {
let nums = checkNumsInArr(args, 3)
if (!nums) {
this.error('Numbers expected as arguments.');
}
let unadjusted = new THREE.Vector3(nums[0], nums[1], nums[2]);
cheatnite.worldedit.pos2 = convertCoords(unadjusted, "true");
addCustomChat('WorldEdit', `pos2 set to ${convertCoords(cheatnite.worldedit.pos2, "adjusted")}`)
} else {
this.error(`Expected 0 or 3 arguments, got ${args.length}.`);
}
return;
}
//generators
WorldEdit.generatePointsNotOf = async function*(pointA, pointB, chunkSize, blockId) {
let start = new THREE.Vector3(Math.floor(pointA.x/5), Math.floor(pointA.y/5), Math.floor(pointA.z/5));
let end = new THREE.Vector3(Math.floor(pointB.x/5), Math.floor(pointB.y/5), Math.floor(pointB.z/5));
let tempPos;
let points = [];
for (let x = Math.min(start.x, end.x); x <= Math.max(start.x, end.x); x++) {
for (let y = Math.min(start.y, end.y); y <= Math.max(start.y, end.y); y++) {
for (let z = Math.min(start.z, end.z); z <= Math.max(start.z, end.z); z++) {
tempPos = new THREE.Vector3(x*5+2.5, y*5+2.5, z*5+2.5);
if (getBlockIdAtPos(tempPos) !== blockId) {
points.push(new THREE.Vector3(x*5+2.5, y*5+2.5, z*5+2.5));
if (points.length >= chunkSize) {
yield points;
points = [];
}
}
}
}
await sleep(10);
if (!cheatnite.worldedit.inprogress) {
yield points;
points = [];
}
}
if (points.length > 0) {
yield points;
}
}
WorldEdit.generateBoxPoints = async function*(pointA, pointB, chunkSize) {
let start = new THREE.Vector3(Math.floor(pointA.x / 5), Math.floor(pointA.y / 5), Math.floor(pointA.z / 5));
let end = new THREE.Vector3(Math.floor(pointB.x / 5), Math.floor(pointB.y / 5), Math.floor(pointB.z / 5));
let tempPos;
let points = [];
for (let x = Math.min(start.x, end.x); x <= Math.max(start.x, end.x); x++) {
for (let y = Math.min(start.y, end.y); y <= Math.max(start.y, end.y); y++) {
for (let z = Math.min(start.z, end.z); z <= Math.max(start.z, end.z); z++) {
if (x === start.x || x === end.x || y === start.y || y === end.y || z === start.z || z === end.z) {
tempPos = new THREE.Vector3(x * 5 + 2.5, y * 5 + 2.5, z * 5 + 2.5);
points.push(tempPos);
if (points.length >= chunkSize) {
yield points;
points = [];
}
}
}
}
await sleep(10);
if (!cheatnite.worldedit.inprogress) {
yield points;
points = [];
}
}
if (points.length > 0) {
yield points;
}
}
/*
WorldEdit.generateSuperellipsoidPoints = async function*(center, radii, exponent1, exponent2, chunkSize) {
const centerX = center.x;
const centerY = center.y;
const centerZ = center.z;
const rx = radii.x;
const ry = radii.y;
const rz = radii.z;
let points = [];
const stepTheta = Math.PI / 50; // Adjust for finer or coarser resolution
const stepPhi = Math.PI / 50;
for (let theta = -Math.PI / 2; theta <= Math.PI / 2; theta += stepTheta) {
for (let phi = -Math.PI; phi <= Math.PI; phi += stepPhi) {
// Superellipsoid parametric equations
const cosTheta = Math.cos(theta);
const sinTheta = Math.sin(theta);
const cosPhi = Math.cos(phi);
const sinPhi = Math.sin(phi);
// Helper functions to handle sign and absolute value with exponents
const signPow = (value, exp) => {
return Math.sign(value) * Math.pow(Math.abs(value), exp);
};
const x = rx * signPow(cosTheta, exponent1) * signPow(cosPhi, exponent2);
const y = ry * signPow(cosTheta, exponent1) * signPow(sinPhi, exponent2);
const z = rz * signPow(sinTheta, exponent1);
const tempPos = new THREE.Vector3(centerX + x, centerY + y, centerZ + z);
points.push(tempPos);
if (points.length >= chunkSize) {
yield points;
points = [];
}
}
await sleep(10);
if (!cheatnite.worldedit.inprogress) {
yield points;
return;
}
}
if (points.length > 0) {
yield points;
}
}
*/
WorldEdit.generateSuperellipsoidPoints = async function*(center, radii, exponent1, exponent2, chunkSize) {
const rx = radii.x;
const ry = radii.y;
const rz = radii.z;
// Define the bounding box for the superellipsoid
const minX = Math.floor((center.x - rx) / 5);
const maxX = Math.ceil((center.x + rx) / 5);
const minY = Math.floor((center.y - ry) / 5);
const maxY = Math.ceil((center.y + ry) / 5);
const minZ = Math.floor((center.z - rz) / 5);
const maxZ = Math.ceil((center.z + rz) / 5);
let points = [];
for (let x = minX; x <= maxX; x++) {
for (let y = minY; y <= maxY; y++) {
for (let z = minZ; z <= maxZ; z++) {
// Calculate the actual position of the block
const posX = x * 5 + 2.5;
const posY = y * 5 + 2.5;
const posZ = z * 5 + 2.5;
// Normalize coordinates relative to the center and radii
const nx = (posX - center.x) / rx;
const ny = (posY - center.y) / ry;
const nz = (posZ - center.z) / rz;
// Calculate the value of the superellipsoid equation
const value = Math.pow(Math.abs(nx), 2 / exponent1) + Math.pow(Math.abs(ny), 2 / exponent2) + Math.pow(Math.abs(nz), 2 / exponent1);
// Determine if the point lies on the surface
// Adjust the threshold (0.05) for desired thickness
if (Math.abs(value - 1) <= 0.05) {
const tempPos = new THREE.Vector3(posX, posY, posZ);
points.push(tempPos);
if (points.length >= chunkSize) {
yield points;
points = [];
}
}
// Optional: For filling the solid shape, use '<= 1' instead
// if (value <= 1.0) {
// // Add point
// }
}
}
// Check for user interruption and yield periodically
await sleep(1);
if (!cheatnite.worldedit.inprogress) {
yield points;
return;
}
}
if (points.length > 0) {
yield points;
}
}
WorldEdit.generateCheckerPoints = async function*(pointA, pointB, chunkSize) {
let start = new THREE.Vector3(Math.floor(pointA.x / 5), Math.floor(pointA.y / 5), Math.floor(pointA.z / 5));
let end = new THREE.Vector3(Math.floor(pointB.x / 5), Math.floor(pointB.y / 5), Math.floor(pointB.z / 5));
let tempPos;
let points = [];
for (let x = Math.min(start.x, end.x); x <= Math.max(start.x, end.x); x++) {
for (let y = Math.min(start.y, end.y); y <= Math.max(start.y, end.y); y++) {
for (let z = Math.min(start.z, end.z); z <= Math.max(start.z, end.z); z++) {
if ((x + y + z) % 2 === 0) {
tempPos = new THREE.Vector3(x * 5 + 2.5, y * 5 + 2.5, z * 5 + 2.5);
points.push(tempPos);
if (points.length >= chunkSize) {
yield points;
points = [];
}
}
}
}
await sleep(10);
if (!cheatnite.worldedit.inprogress) {
yield points;
points = [];
}
}
if (points.length > 0) {
yield points;
}
}
WorldEdit.generateGridPoints = async function*(pointA, pointB, chunkSize, distance) {
let start = new THREE.Vector3(Math.floor(pointA.x / 5), Math.floor(pointA.y / 5), Math.floor(pointA.z / 5));
let end = new THREE.Vector3(Math.floor(pointB.x / 5), Math.floor(pointB.y / 5), Math.floor(pointB.z / 5));
let points = [];
let minX = Math.min(start.x, end.x);
let maxX = Math.max(start.x, end.x);
let minY = Math.min(start.y, end.y);
let maxY = Math.max(start.y, end.y);
let minZ = Math.min(start.z, end.z);
let maxZ = Math.max(start.z, end.z);
for (let x = minX; x <= maxX; x += distance) {
for (let y = minY; y <= maxY; y += distance) {
for (let z = minZ; z <= maxZ; z += distance) {
let tempPos = new THREE.Vector3(x * 5 + 2.5, y * 5 + 2.5, z * 5 + 2.5);
points.push(tempPos);
if (points.length >= chunkSize) {
yield points;
points = [];
}
}
}
await sleep(10);
if (!cheatnite.worldedit.inprogress) {
yield points;
points = [];
return;
}
}
if (points.length > 0) {
yield points;
}
}
WorldEdit.setgrid = async function(start, end, blockName, distance) {
cheatnite.worldedit.inprogress = "setgrid";
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', `Creating a grid pattern from ${convertCoords(start, "adjusted")} to ${convertCoords(end, "adjusted")} with '${blockName}' blocks every ${distance} blocks...`);
let blockId = blocks[blockName];
let chunkSize = 30000;
let generator = this.generateGridPoints(start, end, chunkSize, distance);
for await (let chunk of generator) {
await a637(chunk, this.createBlockArr(chunk.length, blockId), () => {
addCustomChat('WorldEdit', 'Stopped //setgrid command.');
});
if (!cheatnite.worldedit.inprogress)
return;
}
cheatnite.worldedit.inprogress = false;
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', 'Completed //setgrid command.');
}
WorldEdit.lock = async function(start, end) {
cheatnite.worldedit.inprogress = "lock";
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', `Locking region ${convertCoords(start, "adjusted")} - ${convertCoords(end, "adjusted")}...`);
const lockedRegion = await this.copyChunks(start, end);
if (!cheatnite.worldedit.lockedRegions) {
cheatnite.worldedit.lockedRegions = [];
}
cheatnite.worldedit.lockedRegions.push(lockedRegion);
this.startLockMonitor();
cheatnite.worldedit.inprogress = false;
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', 'Region locked successfully.');
}
WorldEdit.unlock = function() {
cheatnite.worldedit.lockedRegions = [];
if (this.lockMonitorInterval) {
clearInterval(this.lockMonitorInterval);
this.lockMonitorInterval = null;
}
addCustomChat('WorldEdit', 'All regions unlocked.');
}
WorldEdit.startLockMonitor = function() {
if (this.lockMonitorInterval) {
clearInterval(this.lockMonitorInterval);
}
this.lockMonitorInterval = setInterval(async () => {
if (!cheatnite.worldedit.lockedRegions || cheatnite.worldedit.lockedRegions.length === 0) {
clearInterval(this.lockMonitorInterval);
this.lockMonitorInterval = null;
return;
}
for (const region of cheatnite.worldedit.lockedRegions) {
await this.checkAndRestoreRegion(region);
}
}, 5000); // Check every 5 seconds
}
WorldEdit.checkAndRestoreRegion = async function(region) {
const [start, end, volumes] = region;
let restoredBlocks = 0;
for (let x = start.x; x <= end.x; x++) {
for (let y = start.y; y <= end.y; y++) {
for (let z = start.z; z <= end.z; z++) {
const pos = new THREE.Vector3(x*5+2.5, y*5+2.5, z*5+2.5);
const [chunkCoords, insidePos] = posTochunk(pos);
const [cx, cy, cz] = chunkCoords;
const key = [cx, cy, cz].join(',');
const chunkData = volumes[key];
if (!chunkData) continue;
const lockedBlockId = chunkData[1][insidePos];
const currentBlockId = getBlockIdAtPos(pos);
if (lockedBlockId !== currentBlockId) {
try {
await this.placeBlock(cx, cy, cz, insidePos, lockedBlockId);
restoredBlocks++;
} catch (error) {
console.error('Error placing block:', error);
}
}
}
}
await sleep(10); // To prevent freezing the game
}
if (restoredBlocks > 0) {
addCustomChat('WorldEdit', `Restored ${restoredBlocks} blocks`);
}
}
WorldEdit.placeBlock = function(cx, cy, cz, insidePos, blockId) {
return new Promise((resolve, reject) => {
try {
let pkt = new a234();
pkt.i = cx;
pkt.e = cy;
pkt.o = cz;
pkt.v = insidePos;
pkt.u = blockId;
G.socket.send(pkt.a614());
resolve();
} catch (error) {
reject(error);
}
});
}
WorldEdit.generatePointsFromLockedRegion = async function*(start, end, volumes, chunkSize = 100) {
let count = 0;
let chunkXList = [];
let chunkYList = [];
let chunkZList = [];
let insidePositionsList = [];
let blockIdsList = [];
for (let x = start.x; x <= end.x; x++) {
for (let y = start.y; y <= end.y; y++) {
for (let z = start.z; z <= end.z; z++) {
const pos = new THREE.Vector3(x*5+2.5, y*5+2.5, z*5+2.5);
const [chunkCoords, insidePos] = posTochunk(pos);
const [cx, cy, cz] = chunkCoords;
const key = [cx, cy, cz].join(',');
const chunkData = volumes[key];
if (!chunkData) continue;
const lockedBlockId = chunkData[1][insidePos];
const currentBlockId = getBlockIdAtPos(pos);
if (lockedBlockId !== currentBlockId) {
chunkXList.push(cx);
chunkYList.push(cy);
chunkZList.push(cz);
insidePositionsList.push(insidePos);
blockIdsList.push(lockedBlockId);
count++;
if (count >= chunkSize) {
yield [chunkXList, chunkYList, chunkZList, insidePositionsList, blockIdsList];
chunkXList = [];
chunkYList = [];
chunkZList = [];
insidePositionsList = [];
blockIdsList = [];
count = 0;
}
}
}
}
await sleep(10);
}
if (count > 0) {
yield [chunkXList, chunkYList, chunkZList, insidePositionsList, blockIdsList];
}
}
WorldEdit.generateAllPoints = async function*(playerPos, chunkSize) {
let points = [];
let blockIds = [];
let allBlockIds = Object.values(blocks);
let blockIndex = 0;
// Define the area around the player (adjust these values as needed)
let radius = Math.ceil(Math.sqrt(allBlockIds.length)); // Make it square to fit all blocks
let y = Math.floor(playerPos.y / 5); // Keep it flat on player's Y level
let startX = Math.floor((playerPos.x - radius * 5) / 5);
let startZ = Math.floor((playerPos.z - radius * 5) / 5);
for (let x = startX; x < startX + radius * 2; x++) {
for (let z = startZ; z < startZ + radius * 2; z++) {
if (blockIndex >= allBlockIds.length) {
if (points.length > 0) {
yield [points, blockIds];
}
yield null; // Signal that all blocks have been placed
return;
}
let tempPos = new THREE.Vector3(x * 5 + 2.5, y * 5 + 2.5, z * 5 + 2.5);
points.push(tempPos);
blockIds.push(allBlockIds[blockIndex]);
blockIndex++;
if (points.length >= chunkSize) {
yield [points, blockIds];
points = [];
blockIds = [];
}
}
await sleep(10);
if (!cheatnite.worldedit.inprogress) {
if (points.length > 0) {
yield [points, blockIds];
}
return;
}
}
if (points.length > 0) {
yield [points, blockIds];
}
}
//get all points of a certain blockId
WorldEdit.generatePointsOf = async function*(pointA, pointB, blockId, chunkSize) {
let start = new THREE.Vector3(Math.floor(pointA.x/5), Math.floor(pointA.y/5), Math.floor(pointA.z/5));
let end = new THREE.Vector3(Math.floor(pointB.x/5), Math.floor(pointB.y/5), Math.floor(pointB.z/5));
let tempPos;
let points = [];
for (let x = Math.min(start.x, end.x); x <= Math.max(start.x, end.x); x++) {
for (let y = Math.min(start.y, end.y); y <= Math.max(start.y, end.y); y++) {
for (let z = Math.min(start.z, end.z); z <= Math.max(start.z, end.z); z++) {
tempPos = new THREE.Vector3(x*5+2.5, y*5+2.5, z*5+2.5);
if (getBlockIdAtPos(tempPos) == blockId) {
points.push(new THREE.Vector3(x*5+2.5, y*5+2.5, z*5+2.5));
if (points.length >= chunkSize) {
yield points;
points = [];
}
}
}
}
await sleep(10);
if (!cheatnite.worldedit.inprogress) {
yield points;
points = [];
}
}
if (points.length > 0) {
yield points;
}
}
WorldEdit.generateSpherePoints = async function*(centerPoint, radius, chunkSize, blockId) {
let points = [];
let radiusSquared = radius * radius;
let minX = Math.floor((centerPoint.x - radius) / 5);
let maxX = Math.floor((centerPoint.x + radius) / 5);
let minY = Math.floor((centerPoint.y - radius) / 5);
let maxY = Math.floor((centerPoint.y + radius) / 5);
let minZ = Math.floor((centerPoint.z - radius) / 5);
let maxZ = Math.floor((centerPoint.z + radius) / 5);
let tempPos;
for (let x = minX; x <= maxX; x++) {
for (let y = minY; y <= maxY; y++) {
for (let z = minZ; z <= maxZ; z++) {
tempPos = new THREE.Vector3(x * 5 + 2.5, y * 5 + 2.5, z * 5 + 2.5);
let distanceSquared = tempPos.distanceToSquared(centerPoint);
if (distanceSquared <= radiusSquared && getBlockIdAtPos(tempPos) !== blockId) {
points.push(tempPos);
if (points.length >= chunkSize) {
yield points;
points = [];
}
}
}
}
await sleep(10);
if (!cheatnite.worldedit.inprogress) {
yield points;
points = [];
}
}
if (points.length > 0) {
yield points;
}
}
WorldEdit.generateHollowSpherePoints = async function*(centerPoint, radius, chunkSize, blockId) {
let points = [];
let radiusSquared = radius * radius;
let innerRadiusSquared = (radius - 1) * (radius - 1);
let minX = Math.floor((centerPoint.x - radius) / 5);
let maxX = Math.floor((centerPoint.x + radius) / 5);
let minY = Math.floor((centerPoint.y - radius) / 5);
let maxY = Math.floor((centerPoint.y + radius) / 5);
let minZ = Math.floor((centerPoint.z - radius) / 5);
let maxZ = Math.floor((centerPoint.z + radius) / 5);
let tempPos;
for (let x = minX; x <= maxX; x++) {
for (let y = minY; y <= maxY; y++) {
for (let z = minZ; z <= maxZ; z++) {
tempPos = new THREE.Vector3(x * 5 + 2.5, y * 5 + 2.5, z * 5 + 2.5);
let distanceSquared = tempPos.distanceToSquared(centerPoint);
if (distanceSquared <= radiusSquared && getBlockIdAtPos(tempPos) !== blockId) {
let isOnSurface = false;
for (let dx = -1; dx <= 1; dx++) {
for (let dy = -1; dy <= 1; dy++) {
for (let dz = -1; dz <= 1; dz++) {
let neighborPos = new THREE.Vector3(tempPos.x + dx * 5, tempPos.y + dy * 5, tempPos.z + dz * 5);
let neighborDistanceSquared = neighborPos.distanceToSquared(centerPoint);
if (neighborDistanceSquared >= innerRadiusSquared) {
isOnSurface = true;
break;
}
}
if (isOnSurface) break;
}
if (isOnSurface) break;
}
if (isOnSurface) {
points.push(tempPos);
if (points.length >= chunkSize) {
yield points;
points = [];
}
}
}
}
}
await sleep(10);
if (!cheatnite.worldedit.inprogress) {
yield points;
points = [];
}
}
if (points.length > 0) {
yield points;
}
}
WorldEdit.generateLinePoints = async function*(pos1, pos2, radius, chunkSize, blockId) {
let points = [];
let radiusSquared = radius * radius;
let dir = pos2.clone().sub(pos1);
let length = dir.length();
let unitDir = dir.clone().normalize();
// Determine the bounding box
let minX = Math.floor((Math.min(pos1.x, pos2.x) - radius) / 5);
let maxX = Math.floor((Math.max(pos1.x, pos2.x) + radius) / 5);
let minY = Math.floor((Math.min(pos1.y, pos2.y) - radius) / 5);
let maxY = Math.floor((Math.max(pos1.y, pos2.y) + radius) / 5);
let minZ = Math.floor((Math.min(pos1.z, pos2.z) - radius) / 5);
let maxZ = Math.floor((Math.max(pos1.z, pos2.z) + radius) / 5);
let tempPos;
for (let x = minX; x <= maxX; x++) {
for (let y = minY; y <= maxY; y++) {
for (let z = minZ; z <= maxZ; z++) {
tempPos = new THREE.Vector3(x * 5 + 2.5, y * 5 + 2.5, z * 5 + 2.5);
// Compute vector from pos1 to tempPos
let p = tempPos.clone().sub(pos1);
// Project p onto dir
let t = p.dot(unitDir);
// Check if t is within [0, length]
if (t < 0 || t > length) {
continue;
}
// Closest point on the line
let closestPoint = pos1.clone().add(unitDir.clone().multiplyScalar(t));
// Distance squared from tempPos to closest point
let distanceSquared = tempPos.distanceToSquared(closestPoint);
if (distanceSquared <= radiusSquared && getBlockIdAtPos(tempPos) !== blockId) {
points.push(tempPos);
if (points.length >= chunkSize) {
yield points;
points = [];
}
}
}
}
await sleep(10);
if (!cheatnite.worldedit.inprogress) {
yield points;
points = [];
}
}
if (points.length > 0) {
yield points;
}
}
WorldEdit.generateHollowLinePoints = async function*(pos1, pos2, radius, chunkSize, blockId) {
// Adjustable block size variable
let blockSize = 5; // Change as needed
// Wall thickness adjustment
let wallThickness = 5; // Increase wall thickness by 1 block
let points = [];
let outerRadiusSquared = radius * radius;
let innerRadius = radius - wallThickness;
let innerRadiusSquared = innerRadius * innerRadius;
let dir = pos2.clone().sub(pos1);
let length = dir.length();
let unitDir = dir.clone().normalize();
// Determine the bounding box
let minX = Math.floor((Math.min(pos1.x, pos2.x) - radius) / blockSize);
let maxX = Math.floor((Math.max(pos1.x, pos2.x) + radius) / blockSize);
let minY = Math.floor((Math.min(pos1.y, pos2.y) - radius) / blockSize);
let maxY = Math.floor((Math.max(pos1.y, pos2.y) + radius) / blockSize);
let minZ = Math.floor((Math.min(pos1.z, pos2.z) - radius) / blockSize);
let maxZ = Math.floor((Math.max(pos1.z, pos2.z) + radius) / blockSize);
let tempPos;
for (let x = minX; x <= maxX; x++) {
for (let y = minY; y <= maxY; y++) {
for (let z = minZ; z <= maxZ; z++) {
// Calculate the block center position
tempPos = new THREE.Vector3(
x * blockSize + blockSize / 2,
y * blockSize + blockSize / 2,
z * blockSize + blockSize / 2
);
// Compute vector from pos1 to tempPos
let p = tempPos.clone().sub(pos1);
// Project p onto dir
let t = p.dot(unitDir);
// Check if t is within [0, length]
if (t < 0 || t > length) {
continue;
}
// Closest point on the line
let closestPoint = pos1.clone().add(unitDir.clone().multiplyScalar(t));
// Distance squared from tempPos to closest point
let distanceSquared = tempPos.distanceToSquared(closestPoint);
// Check if the block is within the hollow cylinder shell
if (
distanceSquared <= outerRadiusSquared &&
distanceSquared >= innerRadiusSquared &&
getBlockIdAtPos(tempPos) !== blockId
) {
points.push(tempPos);
if (points.length >= chunkSize) {
yield points;
points = [];
}
}
}
}
await sleep(10);
if (!cheatnite.worldedit.inprogress) {
yield points;
return;
}
}
if (points.length > 0) {
yield points;
}
}
WorldEdit.copyChunks = async function(pointA, pointB) {
let start = new THREE.Vector3(Math.floor(pointA.x/5), Math.floor(pointA.y/5), Math.floor(pointA.z/5));
let end = new THREE.Vector3(Math.floor(pointB.x/5), Math.floor(pointB.y/5), Math.floor(pointB.z/5));
let tempPos, tempBlock;
let i, e, o;
let chunk, volume;
let key;
let volumes = {};
let minX = Math.min(start.x, end.x);
let minY = Math.min(start.y, end.y);
let minZ = Math.min(start.z, end.z);
let maxX = Math.max(start.x, end.x);
let maxY = Math.max(start.y, end.y);
let maxZ = Math.max(start.z, end.z);
for (let x = minX; x <= maxX; x++) {
if (x % 32 !== 0 && x !== minX && x !== maxX) continue;
for (let y = minY; y <= maxY; y++) {
if (y % 32 !== 0 && y !== minY && y !== maxY) continue;
for (let z = minZ; z <= maxZ; z++) {
if (z % 32 !== 0 && z !== minZ && z !== maxZ) continue;
tempPos = new THREE.Vector3(x*5+2.5, y*5+2.5, z*5+2.5);
[i, e, o] = GAME.a865.getChunkFromPos(tempPos);
if (i>160 || e>160 || o>160)
continue;
chunk = GAME.a865.a643s[i][e][o];
volume = chunk?.volume;
key = [i, e, o].join(',');
if (volume) {
volumes[key] = [chunk.buildP.clone(), volume];
} else {
volumes[key] = [new THREE.Vector3(i*32*5, e*32*5, o*32*5), new Uint8Array(32768)]
}
}
}
await sleep(1);
}
return [
new THREE.Vector3(minX, minY, minZ),
new THREE.Vector3(maxX, maxY, maxZ),
volumes,
];
};
WorldEdit.generatePointsFromClipboard = async function*(chunkSize = 100, newStart = null) {
// cb stands for clipboard
let [start, end, cbVolumes] = cheatnite.worldedit.clipboard;
const diff = newStart ? new THREE.Vector3(Math.floor(newStart.x/5), Math.floor(newStart.y/5), Math.floor(newStart.z/5)).sub(start) : new THREE.Vector3(0,0,0);
let count = 0;
let chunkXList = [];
let chunkYList = [];
let chunkZList = [];
let insidePositionsList = [];
let blockIdsList = [];
for (let x = start.x; x <= end.x; x++) {
for (let y = start.y; y <= end.y; y++) {
for (let z = start.z; z <= end.z; z++) {
const oldPos = new THREE.Vector3(x*5+2.5, y*5+2.5, z*5+2.5);
const chunkCoords = GAME.a865.getChunkFromPos(oldPos);
const chunkData = cbVolumes[chunkCoords.join(',')];
if (!chunkData)
continue;
const insidePos = customPosToV(oldPos, chunkData[0]);
const blockId = chunkData[1][insidePos];
const [newChunkCoords, newInsidePos] = posTochunk(oldPos.clone().add(diff.clone().multiplyScalar(5)));
const [newCx, newCy, newCz] = newChunkCoords;
const currentBlock = GAME.a865.a643s[newCx][newCy][newCz]?.volume?.[newInsidePos];
if (blockId === currentBlock)
continue;
chunkXList.push(newCx);
chunkYList.push(newCy);
chunkZList.push(newCz);
insidePositionsList.push(newInsidePos);
blockIdsList.push(blockId);
count++;
if (count >= chunkSize) {
yield [chunkXList, chunkYList, chunkZList, insidePositionsList, blockIdsList];
chunkXList = [];
chunkYList = [];
chunkZList = [];
insidePositionsList = [];
blockIdsList = [];
count = 0;
}
}
}
await sleep(10);
}
if (count) {
yield [chunkXList, chunkYList, chunkZList, insidePositionsList, blockIdsList];
}
};
// Implement exportBuild function
WorldEdit.exportBuild = function(buildName) {
const buildData = cheatnite.worldedit.builds[buildName];
if (!buildData) {
WorldEdit.error(`Build '${buildName}' does not exist.`);
return;
}
const filename = buildName + '.txt';
const dataStr = JSON.stringify(buildData);
const blob = new Blob([dataStr], { type: 'text/plain;charset=utf-8' });
const url = URL.createObjectURL(blob);
const a = document.createElement('a');
a.href = url;
a.download = filename;
a.style.display = 'none';
document.body.appendChild(a);
a.click();
document.body.removeChild(a);
URL.revokeObjectURL(url);
addCustomChat('WorldEdit', `Exported build '${buildName}' to ${filename}.`);
};
// Implement saveToBuild function
WorldEdit.saveToBuild = async function(pointA, pointB, buildName) {
cheatnite.worldedit.inprogress = "save";
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', `Saving selection to build '${buildName}'...`);
const [start, end, volumes] = await this.copyChunks(pointA, pointB);
const buildData = [];
const blockIDsToNames = invertObject(blocks); // Invert the blocks mapping to get names from IDs
const minX = Math.min(start.x, end.x);
const minY = Math.min(start.y, end.y);
const minZ = Math.min(start.z, end.z);
const maxX = Math.max(start.x, end.x);
const maxY = Math.max(start.y, end.y);
const maxZ = Math.max(start.z, end.z);
for (let x = minX; x <= maxX; x++) {
for (let y = minY; y <= maxY; y++) {
for (let z = minZ; z <= maxZ; z++) {
const pos = new THREE.Vector3(x * 5 + 2.5, y * 5 + 2.5, z * 5 + 2.5);
const [chunkCoords, insidePos] = posTochunk(pos);
const chunkKey = chunkCoords.join(',');
const volumeData = volumes[chunkKey];
if (!volumeData) continue;
const blockId = volumeData[1][insidePos];
if (blockId && blockId !== 0) {
const blockName = blockIDsToNames[blockId];
if (!blockName) continue; // Skip unknown block IDs
// Store relative positions
buildData.push({
pos: [x - minX, y - minY, z - minZ],
name: blockName
});
}
}
}
await sleep(1); // Yield execution to prevent blocking
}
cheatnite.worldedit.builds[buildName] = buildData;
cheatnite.worldedit.inprogress = false;
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', `Saved selection as build '${buildName}' with ${buildData.length} blocks.`);
};
// Helper function to invert the blocks mapping
function invertObject(obj) {
const inverted = {};
for (const key in obj) {
if (obj.hasOwnProperty(key)) {
inverted[obj[key]] = key;
}
}
return inverted;
}
// Ensure posTochunk function exists and returns both chunk coordinates and inside position
function posTochunk(pos) {
const chunkX = Math.floor(pos.x / (32 * 5));
const chunkY = Math.floor(pos.y / (32 * 5));
const chunkZ = Math.floor(pos.z / (32 * 5));
const insideX = Math.floor((pos.x % (32 * 5)) / 5);
const insideY = Math.floor((pos.y % (32 * 5)) / 5);
const insideZ = Math.floor((pos.z % (32 * 5)) / 5);
const insidePos = insideX + insideY * 32 + insideZ * 1024;
return [[chunkX, chunkY, chunkZ], insidePos];
}
// Ensure getBuildName function exists
function getBuildName(filename) {
if (filename === '') {
filename = '';
}
filename = filename.replace(/ /g, '_');
while (Object.keys(cheatnite.worldedit.builds).includes(filename)) {
if (/\d+$/.test(filename)) {
filename = filename.replace(/(\d+)$/, (match, p1) => parseInt(p1) + 1);
} else {
filename = filename + '1';
}
}
return filename;
}
// Provide error function if not exists
WorldEdit.error = function(message) {
addCustomChat('WorldEdit', `Error: ${message}`);
};
// Implement loadBuild function
WorldEdit.loadBuild = function() {
const input = document.createElement('input');
input.type = 'file';
input.accept = '.txt';
input.onchange = function(event) {
const file = event.target.files[0];
if (!file) {
WorldEdit.error('No file selected.');
return;
}
const reader = new FileReader();
reader.onload = function(e) {
try {
const buildData = JSON.parse(e.target.result);
const buildName = getBuildName(file.name.replace('.txt', ''));
cheatnite.worldedit.builds[buildName] = buildData;
addCustomChat('WorldEdit', `Loaded build '${buildName}' from file '${file.name}'.`);
} catch (err) {
WorldEdit.error(`Error loading build: ${err.message}`);
}
};
reader.readAsText(file);
};
input.click();
};
WorldEdit.generatePointsFromBuild = async function*(buildName, start, chunkSize) {
let tempPos;
let shiftedPoints = [];
let buildBlockIds = [];
const buildBlocks = cheatnite.worldedit.builds[buildName];
// Convert 'start' to grid units
let startGrid = new THREE.Vector3(
Math.floor(start.x / 5),
Math.floor(start.y / 5),
Math.floor(start.z / 5)
);
for (let i = 0; i < buildBlocks.length; i++) {
// Calculate world position
tempPos = new THREE.Vector3(
(buildBlocks[i].pos[0] + startGrid.x) * 5 + 2.5,
(buildBlocks[i].pos[1] + startGrid.y) * 5 + 2.5,
(buildBlocks[i].pos[2] + startGrid.z) * 5 + 2.5
);
const blockId = blocks[buildBlocks[i].name];
if (getBlockIdAtPos(tempPos) !== blockId) {
shiftedPoints.push(tempPos.clone());
buildBlockIds.push(blockId);
if (shiftedPoints.length >= chunkSize) {
yield [shiftedPoints, buildBlockIds];
shiftedPoints = [];
buildBlockIds = [];
}
}
}
if (shiftedPoints.length) {
yield [shiftedPoints, buildBlockIds];
}
};
//actors
WorldEdit.set = async function(start, end, blockName) {
cheatnite.worldedit.inprogress = "set";
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', `Setting ${convertCoords(start, "adjusted")} - ${convertCoords(end, "adjusted")} to ${blockName} blocks...`);
let blockId = blocks[blockName];
let chunkSize = 30000;
let generator = this.generatePointsNotOf(start, end, chunkSize, blockId);
for await (let chunk of generator) {
await a637(chunk, this.createBlockArr(chunk.length, blockId), ()=>{
addCustomChat('WorldEdit', 'Stopped //set command.');
});
if (!cheatnite.worldedit.inprogress)
return;
}
cheatnite.worldedit.inprogress = false;
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', 'Completed //set command.');
}
WorldEdit.setchecker = async function(start, end, blockName) {
cheatnite.worldedit.inprogress = "setchecker";
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', `Creating a checker pattern from ${convertCoords(start, "adjusted")} to ${convertCoords(end, "adjusted")} using ${blockName} blocks...`);
let blockId = blocks[blockName];
let chunkSize = 30000;
let generator = this.generateCheckerPoints(start, end, chunkSize);
for await (let chunk of generator) {
await a637(chunk, this.createBlockArr(chunk.length, blockId), ()=>{
addCustomChat('WorldEdit', 'Stopped //setchecker command.');
});
if (!cheatnite.worldedit.inprogress)
return;
}
cheatnite.worldedit.inprogress = false;
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', 'Completed //setchecker command.');
}
WorldEdit.replacechecker = async function(start, end, blockIdStart, blockNameEnd) {
cheatnite.worldedit.inprogress = "replacechecker";
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', `Replacing ${BLOCK_CONFIG[blockIdStart].name} with ${blockNameEnd} in a checker pattern from ${convertCoords(start, "adjusted")} to ${convertCoords(end, "adjusted")}...`);
let blockIdEnd = blocks[blockNameEnd];
if (blockIdStart === blockIdEnd) {
cheatnite.worldedit.inprogress = false;
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', 'Completed //replacechecker command.');
return;
}
let chunkSize = 30000;
let generator = this.generateCheckerPointsOf(start, end, chunkSize, blockIdStart);
for await (let chunk of generator) {
await a637(chunk, this.createBlockArr(chunk.length, blockIdEnd), () => {
addCustomChat('WorldEdit', 'Stopped //replacechecker command.');
});
if (!cheatnite.worldedit.inprogress)
return;
}
cheatnite.worldedit.inprogress = false;
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', 'Completed //replacechecker command.');
}
WorldEdit.palette = async function() {
cheatnite.worldedit.inprogress = "palette";
cheatnite.updateCheatDisp = true;
let playerPos = GAME.a865.player.position.clone();
addCustomChat('WorldEdit', `Placing all block types at ${convertCoords(playerPos, "adjusted")}...`);
let chunkSize = 30000;
let generator = this.generateAllPoints(playerPos, chunkSize);
for await (let chunk of generator) {
if (chunk === null) {
break; // All blocks have been placed
}
await a637(chunk[0], chunk[1], ()=>{
addCustomChat('WorldEdit', 'Stopped //palette command.');
});
if (!cheatnite.worldedit.inprogress)
return;
}
cheatnite.worldedit.inprogress = false;
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', 'Completed //palette command.');
}
WorldEdit.box = async function(start, end, blockName) {
cheatnite.worldedit.inprogress = "box";
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', `Generating a box from ${convertCoords(start, "adjusted")} to ${convertCoords(end, "adjusted")} using ${blockName} blocks...`);
let blockId = blocks[blockName];
let chunkSize = 30000;
let generator = this.generateBoxPoints(start, end, chunkSize, blockId);
for await (let chunk of generator) {
await a637(chunk, this.createBlockArr(chunk.length, blockId), ()=>{
addCustomChat('WorldEdit', 'Stopped //box command.');
});
if (!cheatnite.worldedit.inprogress)
return;
}
cheatnite.worldedit.inprogress = false;
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', 'Completed //box command.');
}
WorldEdit.superellipsoid = async function(center, radii, exponent1, exponent2, blockName) {
cheatnite.worldedit.inprogress = "superellipsoid";
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', `Generating a superellipsoid at ${convertCoords(center, "adjusted")} with radii ${JSON.stringify(radii)} and exponents (${exponent1}, ${exponent2}) using ${blockName} blocks...`);
let blockId = blocks[blockName];
let chunkSize = 30000;
let generator = this.generateSuperellipsoidPoints(center, radii, exponent1, exponent2, chunkSize);
for await (let chunk of generator) {
await a637(chunk, this.createBlockArr(chunk.length, blockId), () => {
addCustomChat('WorldEdit', 'Stopped //superellipsoid command.');
});
if (!cheatnite.worldedit.inprogress)
return;
}
cheatnite.worldedit.inprogress = false;
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', 'Completed //superellipsoid command.');
}
WorldEdit.replace = async function(start, end, blockIdStart, blockNameEnd) {
cheatnite.worldedit.inprogress = "replace";
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', `Replacing ${BLOCK_CONFIG[blockIdStart].name} with ${blockNameEnd} in ${convertCoords(start, "adjusted")} - ${convertCoords(end, "adjusted")}...`);
let blockIdEnd = blocks[blockNameEnd];
if (blockIdStart === blockIdEnd) {
cheatnite.worldedit.inprogress = false;
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', 'Completed //replace command.');
return;
}
let chunkSize = 30000;
let generator = this.generatePointsOf(start, end, blockIdStart, chunkSize);
for await (let chunk of generator) {
await a637(chunk, this.createBlockArr(chunk.length, blockIdEnd), ()=>{
addCustomChat('WorldEdit', 'Stopped //replace command.');
});
if (!cheatnite.worldedit.inprogress)
return;
}
cheatnite.worldedit.inprogress = false;
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', 'Completed //replace command.');
}
WorldEdit.generateCheckerPointsOf = async function*(pointA, pointB, chunkSize, blockIdStart) {
let start = new THREE.Vector3(Math.floor(pointA.x / 5), Math.floor(pointA.y / 5), Math.floor(pointA.z / 5));
let end = new THREE.Vector3(Math.floor(pointB.x / 5), Math.floor(pointB.y / 5), Math.floor(pointB.z / 5));
let tempPos;
let points = [];
for (let x = Math.min(start.x, end.x); x <= Math.max(start.x, end.x); x++) {
for (let y = Math.min(start.y, end.y); y <= Math.max(start.y, end.y); y++) {
for (let z = Math.min(start.z, end.z); z <= Math.max(start.z, end.z); z++) {
if ((x + y + z) % 2 === 0) {
tempPos = new THREE.Vector3(x * 5 + 2.5, y * 5 + 2.5, z * 5 + 2.5);
// Check block ID at tempPos
if (getBlockIdAtPos(tempPos) === blockIdStart) {
points.push(tempPos);
if (points.length >= chunkSize) {
yield points;
points = [];
}
}
}
}
}
await sleep(10);
if (!cheatnite.worldedit.inprogress) {
yield points;
points = [];
return;
}
}
if (points.length > 0) {
yield points;
}
}
WorldEdit.sphere = async function(centerPoint, blockName, radius) {
cheatnite.worldedit.inprogress = "sphere";
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', `Creating a ${blockName} sphere with center ${convertCoords(centerPoint, "adjusted")} and radius ${radius}...`);
let blockId = blocks[blockName];
let chunkSize = 30000;
let generator = this.generateSpherePoints(centerPoint, radius, chunkSize, blockId);
for await (let chunk of generator) {
await a637(chunk, this.createBlockArr(chunk.length, blockId), ()=>{
addCustomChat('WorldEdit', 'Stopped //sphere command.');
});
if (!cheatnite.worldedit.inprogress)
return;
}
cheatnite.worldedit.inprogress = false;
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', 'Completed //sphere command.');
}
WorldEdit.hollowSphere = async function(centerPoint, blockName, radius) {
cheatnite.worldedit.inprogress = "hollow sphere";
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', `Creating a ${blockName} hollow sphere with center ${convertCoords(centerPoint, "adjusted")} and radius ${radius}...`);
let blockId = blocks[blockName];
let chunkSize = 30000;
let generator = this.generateHollowSpherePoints(centerPoint, radius, chunkSize, blockId);
for await (let chunk of generator) {
await a637(chunk, this.createBlockArr(chunk.length, blockId), ()=>{
addCustomChat('WorldEdit', 'Stopped //hsphere command.');
});
if (!cheatnite.worldedit.inprogress)
return;
}
cheatnite.worldedit.inprogress = false;
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', 'Completed //hsphere command.');
}
WorldEdit.line = async function(pos1, pos2, blockName, radius) {
cheatnite.worldedit.inprogress = "line";
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', `Creating a ${blockName} line from ${convertCoords(pos1, "adjusted")} to ${convertCoords(pos2, "adjusted")} with radius ${radius}...`);
let blockId = blocks[blockName];
let chunkSize = 30000;
let generator = this.generateLinePoints(pos1, pos2, radius, chunkSize, blockId);
for await (let chunk of generator) {
await a637(chunk, this.createBlockArr(chunk.length, blockId), () => {
addCustomChat('WorldEdit', 'Stopped //line command.');
});
if (!cheatnite.worldedit.inprogress)
return;
}
cheatnite.worldedit.inprogress = false;
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', 'Completed //line command.');
}
WorldEdit.copy = async function(start, end) {
addCustomChat('WorldEdit', `Saving volume ${convertCoords(start, "adjusted")} - ${convertCoords(end, "adjusted")} to clipboard...`);
cheatnite.worldedit.clipboard = await this.copyChunks(start, end);
addCustomChat('WorldEdit', 'Saved volume to clipboard.');
}
WorldEdit.hollowLine = async function(pos1, pos2, blockName, radius) {
cheatnite.worldedit.inprogress = "hollow line";
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', `Creating a ${blockName} hollow line from ${convertCoords(pos1, "adjusted")} to ${convertCoords(pos2, "adjusted")} with radius ${radius}...`);
let blockId = blocks[blockName];
let chunkSize = 30000;
let generator = this.generateHollowLinePoints(pos1, pos2, radius, chunkSize, blockId);
for await (let chunk of generator) {
await a637(chunk, this.createBlockArr(chunk.length, blockId), () => {
addCustomChat('WorldEdit', 'Stopped //hline command.');
});
if (!cheatnite.worldedit.inprogress)
return;
}
cheatnite.worldedit.inprogress = false;
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', 'Completed //hline command.');
}
//needs to be converted to new system
WorldEdit.paste = async function(start) {
cheatnite.worldedit.inprogress = "paste";
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', `Pasting clipboard at ${convertCoords(start || cheatnite.worldedit.clipboard[0], "adjusted")}...`);
let chunkSize = 30000;
let generator = this.generatePointsFromClipboard(chunkSize, start);
for await (const [x, y, z, insidePos, blockIds] of generator) {
await rawa637(x, y, z, insidePos, blockIds, ()=>{
addCustomChat('WorldEdit', 'Stopped //paste command.');
})
if (!cheatnite.worldedit.inprogress)
return;
}
cheatnite.worldedit.inprogress = false;
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', 'Pasted volume.');
}
WorldEdit.build = async function(buildName, start) {
cheatnite.worldedit.inprogress = "build";
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', `Building ${buildName} at ${convertCoords(start, "adjusted")}...`);
let chunkSize = 30000;
let generator = this.generatePointsFromBuild(buildName, start, chunkSize);
for await (let chunk of generator) {
await a637(chunk[0], chunk[1], ()=>{
addCustomChat('WorldEdit', 'Stopped /b command.');
});
if (!cheatnite.worldedit.inprogress)
return;
}
cheatnite.worldedit.inprogress = false;
cheatnite.updateCheatDisp = true;
addCustomChat('WorldEdit', 'Finished building '+buildName+'.');
}
//utils
WorldEdit.error = function(msg) {
addCustomChat('WorldEdit.Error', msg);
}
WorldEdit.createBlockArr = function(len, blockId) {
if (typeof(blockId) === 'number') {
// BlockId is a number, returning an array filled with this blockId (e.g., "stone" -> 0).
return Array(len).fill(blockId);
} else if (blockId === 'random') {
// If the blockId is "random", fill the array with random values from printblocks (excluding 0s if needed).
const filteredKeys = Object.keys(printblocks).filter(key => parseInt(key) !== 0);
const arr = Array.from({ length: len }, () => {
return parseInt(filteredKeys[Math.floor(Math.random() * filteredKeys.length)]);
});
return arr;
} else if (blockId === 'items') {
// If blockId is "items", use the 'items' object to fill the array in a cycling order.
const itemKeys = Object.keys(itemblocks);
const arr = Array.from({ length: len }, (_, index) => {
const itemKey = itemKeys[index % itemKeys.length];
return itemblocks[itemKey]; // Get the ID from 'items'
});
return arr;
} else {
// Default behavior for unknown blockId: try to use blocks or fall back to 'random'
if (blocks[blockId]) {
return Array(len).fill(blocks[blockId]);
} else {
const filteredKeys = Object.keys(printblocks).filter(key => parseInt(key) !== 0);
const arr = Array.from({ length: len }, () => {
return parseInt(filteredKeys[Math.floor(Math.random() * filteredKeys.length)]);
});
return arr;
}
}
}
/*
COORDS DISPLAY
and, well, random checks
*/
setInterval(() => {
if (typeof(GAME) !== 'undefined' && GAME?.a865?.player?.position && GAME?.loadingUI.hidden == true) {
let me = GAME.a865.player;
let bottomright = document.getElementById('bottomright');
bottomright.style.display = 'block';
if (!me.dead) {
cheatnite.coords = convertCoords(me.position, "adjusted");
bottomright.textContent = `(${cheatnite.coords.x.toFixed(1)}, ${cheatnite.coords.y.toFixed(1)}, ${cheatnite.coords.z.toFixed(1)})`;
if (GAME?.oceanHeightTo) {
cheatnite.drain = cheatnite.coords.y < 10;
GAME.oceanHeightTo = cheatnite.drain ? -10000 : 317;
}
if (GAME.myKillerId && !G.othera822ers.some((p) => p?.ID === GAME.myKillerId))
GAME.myKillerId = null;
} else {
var newPos = G.othera822ers?.[GAME.myKillerId]?.position || me.position;
let coords = convertCoords(newPos, "adjusted");
bottomright.textContent = `(${coords.x.toFixed(1)}, ${coords.y.toFixed(1)}, ${coords.z.toFixed(1)})`;
}
if (cheatnite.updateCheatDisp) {
//cheat display code inspired by https://greasyfork.org/en/scripts/474923-craftnite-io-hacked-client-fly-triggerbot-esp-rapidfire-speedhacks-and-more
var textArr = cheatnite.activatedCheats;
textArr.sort((a, b) => a.length - b.length);
textArr = textArr.slice(0);
if (cheatnite.customBlockId !== 256)
textArr.push(`Item: ${BLOCK_CONFIG[cheatnite.customBlockId]?.name || cheatnite.customBlockId}`);
if (cheatnite.worldedit.inprogress)
textArr.push(`WorldEdit: ${cheatnite.worldedit.inprogress}`);
var coloredTextArr = textArr.map(function(text, index) {
return '<span style="color: ' + getColor(index, textArr.length) + '">' + text.toUpperCase() + '</span>';
});
cheatnite.cheatDisp.innerHTML = coloredTextArr.join('<br>');
cheatnite.updateCheatDisp = false;
cheatnite.cheatDisp.style.top = (document.documentElement.clientHeight + bottomright.clientHeight*0.5 - (26*textArr.length)) + "px";
}
}
//random annoying ad stuff
var extra = document.getElementsByClassName('truepush_optin_notifications');
if (extra.length)
extra[0].remove();
}, 50);
/*
ESP
*/
function initEsp() {
espGeometry = new THREE.EdgesGeometry(new THREE.BoxGeometry(5, 10, 5).translate(0, -3, 0));
lineMaterial = new THREE.LineBasicMaterial({ color: 0xff0000 });
red = `
void main() {
gl_FragColor = vec4( 1.0, 0.0, 0.0, 1.0 );
}
`;
espMaterial = new THREE.RawShaderMaterial({
vertexShader: `
attribute vec3 position;
uniform mat4 projectionMatrix;
uniform mat4 modelViewMatrix;
void main() {
gl_Position = projectionMatrix * modelViewMatrix * vec4( position, 1.0 );
gl_Position.z = 1.0;
}
`,
fragmentShader: red
});
textCanvas = new G.Canvas2d();
textCanvas.alpha = 0;
textCanvas.init();
}
function animate() {
window.requestAnimationFrame(animate);
const players = [];
for (const p of G.othera822ers)
if (p && p.id && p.id !== GAME.a865.player.id)
players.push(p);
textCanvas.clear();
const drawnTextPositions = [];
const minSpacing = 4;
const textOffset = 24;
for (let i = 0; i < players.length; i++) {
const player = players[i];
if (!player.a472.box) {
const box = new THREE.LineSegments(espGeometry, espMaterial);
box.frustumCulled = false;
player.a472.add(box);
player.a472.box = box;
}
player.a472.box.visible = cheatnite.esp;
if (player.a472.visible && cheatnite.esp) {
const worldPos = new THREE.Vector3();
player.a472.box.getWorldPosition(worldPos);
let screenPos = G.worldPosToScreenCoords(worldPos, GAME.camera, window.innerWidth, window.innerHeight);
if (screenPos.orientation !== 'center')
continue;
let playerName = `(${player.id}) ` + (player.name.length > 20 ? player.name.substring(0, 17) + '...' : player.name);
let color = "#FFFFFF";
if (player.ID === GAME.myKillerId) {
playerName = '(killer) '+playerName;
color = "#FF8080";
}
const textSize = 16;
let yPos = screenPos.coords.y - 10;
for (const drawnPos of drawnTextPositions) {
if (Math.abs(drawnPos.x - screenPos.coords.x) < textSize && Math.abs(drawnPos.y - yPos) < textSize) {
yPos = drawnPos.y - textSize - minSpacing;
}
}
drawnTextPositions.push({ x: screenPos.coords.x, y: yPos });
textCanvas.text(
[screenPos.coords.x, yPos],
playerName,
color,
textSize,
"middle",
"center"
);
}
}
textCanvas.flip();
}
/*
WEBSOCKET
*/
//incoming websocket msgs
let checkInterval = setInterval(() => {
if (typeof(G) !== 'undefined' && typeof(G.socket) !== 'undefined' && G.socket !== null && G.socket.binaryType == "arraybuffer") {
clearInterval(checkInterval);
// Secure WebSocket Proxy
G.socket.onmessage = new Proxy(G.socket.onmessage || function(){}, {
apply: function (target, scope, args) {
try {
var i = new DataView(args[0].data);
let opcode = i.getUint8(0);
// CUSTOM CHECK: Prevent crash if invalid opcode
if (typeof opcode !== "number" || isNaN(opcode)) {
console.warn("⚠️ Invalid Opcode Detected:", opcode);
return; // Ignore & stop processing this message
}
// Anti-crash validation before executing game handlers
if (opcode === 19) {
onDeath(i);
} else if (opcode === G.a823?.RPCMatchRemainingTime) {
var c, ratio;
(c = new RPCMatchRemainingTime).a615(i);
if (!cheatnite.server.time) {
cheatnite.server.r = 3;
} else {
ratio = (Date.now() - cheatnite.server.time) / 1000;
if (ratio >= 1) cheatnite.server.r = ratio;
}
cheatnite.server.time = Date.now();
}
// **CATCH ERRORS BEFORE GAME HANDLES IT**
let data = target.apply(scope, args);
return data;
} catch (err) {
console.warn("🚨 Blocked Malicious WebSocket Message!", err);
return; // Ignore & do not pass bad data to the game
}
}
});
console.log("✅ Anti-Cheat WebSocket Filter Active.");
}
}, 1000);
//outgoing websocket msgs
WebSocket.prototype.send = new Proxy(WebSocket.prototype.send, {
apply: function (target, scope, args) {
var dataView = new DataView(args[0]);
let opcode = dataView.getUint8(0);
if (opcode == 27) {
let blockName, thickess, radius, pID, pkt, player;
let me = GAME.a865.player;
let adjustedCoords = `(${cheatnite.coords.x.toFixed(0)}, ${cheatnite.coords.y.toFixed(0)}, ${cheatnite.coords.z.toFixed(0)})`
let msg = parseOutgoingChat(dataView);
if (msg.startsWith('/')) {
addCustomChat('$', msg)
let splitMsg = msg.split(' ').filter(word => word !== '');
let cmd = splitMsg[0].substr(1).toLowerCase();
let args = splitMsg.slice(1);
switch(cmd) {
//REGULAR cmds
case 'truecoords':
addCustomChat('<', `(${(me.position.x).toFixed(1)}, ${(me.position.y).toFixed(1)}, ${(me.position.z).toFixed(1)})`)
break;
case 'ignore':
pID = parseInt(args[0]);
if (!isNaN(pID)) {
if (!cheatnite.ignored.includes(pID)) {
cheatnite.ignored.push(pID);
addCustomChat('<', `Ignored player with ID ${pID}`);
} else {
addCustomChat('Error', `Player ID ${pID} is already ignored.`);
}
} else {
addCustomChat('Error', 'A number is expected as an argument (the player\'s ID).');
}
break;
case 'unignore':
pID = parseInt(args[0]);
if (!isNaN(pID)) {
if (cheatnite.ignored.includes(pID)) {
cheatnite.ignored = cheatnite.ignored.filter(item => item !== pID);
addCustomChat('<', `Unignored player with ID ${pID}`);
} else {
addCustomChat('Error', `Player ID ${pID} is not in ignored list.`);
}
} else {
addCustomChat('Error', 'A number is expected as an argument (the player\'s ID).');
}
break;
case 'unstuck':
G.a597.rebound.enabled = true;
addCustomChat('<', 'Unstuck.');
break
case 'drain':
cheatnite.drain = !cheatnite.drain;
GAME.oceanHeightTo = cheatnite.drain ? -10000 : 317;
addCustomChat('<', cheatnite.drain ? 'Ocean gone (for client).' : 'Ocean is back.');
break;
case 'ocean':
cheatnite.ocean = !cheatnite.ocean;
GAME.oceanPlane.position.y = cheatnite.ocean ? -100 : 317;
addCustomChat('<', cheatnite.ocean ? 'Ocean set to -100 (for client).' : 'Ocean is back to normal.');
break;
case 'item':
if (args.length === 0) {
cheatnite.customBlockId = getLookAtBlockId();
} else if (checkInt(args[0]) && Object.keys(BLOCK_CONFIG).includes(args[0])) {
cheatnite.customBlockId = parseInt(args[0]);
} else if (Object.keys(blocks).includes(args[0].toLowerCase())) {
cheatnite.customBlockId = blocks[args[0].toLowerCase()];
} else {
addCustomChat('Error', `Block ${args[0]} does not exist.`);
return;
}
if (!cheatnite.customBlockId) {
//if not looking at a block / set air block
addCustomChat('<', 'Reset stone items.');
return;
}
var stoneNeeded = 1000 - countItemInInv("stone");
if (stoneNeeded > 0) {
GAME.a865.player.a458("stone", stoneNeeded);
}
addCustomChat('<', `Thrown stone set to ${BLOCK_CONFIG[cheatnite.customBlockId]?.name || cheatnite.customBlockId}.`);
break;
case 'invsize':
if (args.length === 0) {
GAME.a865.player.totalShorta843 = 4;
addCustomChat('<', 'Inventory size reset.')
} else if (checkInt(args[0]) && parseInt(args[0])>=0 && parseInt(args[0])<=35) {
GAME.a865.player.totalShorta843 = parseInt(args[0]);
addCustomChat('<', 'Inventory size set to '+args[0]+'.')
} else {
addCustomChat('Error', 'Invalid input. Expected an integer between 0 and 35, inclusive.')
}
break;
case 'tp':
if (args.length === 1) {
// Attempt to parse the argument as a player ID
let pID = parseInt(args[0]);
if (!isNaN(pID)) {
// Find the player with the given ID
let player = G.othera822ers.find(p => p?.id === pID);
if (!player) {
addCustomChat('Error', `Player with ID ${pID} not found.`);
return;
}
// Teleport to the player's position
tp(player.position);
addCustomChat('>', `Teleported to player ${player.id}.`);
} else {
addCustomChat('Error', 'A number is expected as an argument (the player\'s ID).');
}
} else if (args.length === 3) {
// Check that all three arguments are numbers
let nums = checkNumsInArr(args, 3);
if (!nums) {
addCustomChat('Error', 'Numbers expected as coordinates.');
return;
}
// Create a vector from the input coordinates
let unadjusted = new THREE.Vector3(nums[0], nums[1], nums[2]);
// Convert adjusted coordinates to true game coordinates
let trueCoords = convertCoords(unadjusted, "true");
// Teleport to the specified coordinates
tp(trueCoords);
addCustomChat('>', `Teleported to coordinates (${nums[0]}, ${nums[1]}, ${nums[2]}).`);
} else {
addCustomChat('Error', `Expected 1 or 3 arguments, got ${args.length}.`);
}
break;
case 'time':
if (args.length < 2 || args[0].toLowerCase() !== 'set') {
addCustomChat('Error', 'Expected at 2 args: set and (day/night).')
return;
}
if (args[1].toLowerCase() === 'night') {
cheatnite.darkMode = true;
G.CONFIG.a133 = new THREE.Color("rgb(0, 0, 0)");
} else {
cheatnite.darkMode = false;
G.CONFIG.a133 = G.CONFIG.a134;
}
GAME.updatea668(false);
addCustomChat('<', `Time set to ${cheatnite.darkMode ? 'night' : 'day'}.`);
break;
case 'bgcolor':
if (args.length < 1) {
addCustomChat('Error', 'Expected 1 arg: hex color value (e.g., #RRGGBB).');
return;
}
const hexColor = args[0];
if (!/^#[0-9A-Fa-f]{6}$/.test(hexColor)) {
addCustomChat('Error', 'Invalid hex color format. Use #RRGGBB.');
return;
}
G.CONFIG.a133 = new THREE.Color(hexColor);
GAME.updatea668(false);
addCustomChat('<', `Background color set to ${hexColor}.`);
break;
case 'bg':
if (args.length) {
if (isURL(args[0])) {
addCustomChat('<', 'Loading background image from url...');
loadBackgroundTexture(args[0]);
}
return;
}
//upload
var input = document.createElement('input');
input.type = 'file';
input.onchange = (event) => {
addCustomChat('<', 'Loading background image from file...');
const file = event.target.files[0];
const reader = new FileReader();
reader.onload = (event) => {
loadBackgroundTexture(event.target.result);
};
reader.readAsDataURL(file);
};
input.click();
break;
case 'texture':
if (args.length) {
if (isURL(args[0])) {
addCustomChat('<', 'Loading world texture from url...');
loadWorldTexture(args[0]);
}
return;
}
//upload
var input = document.createElement('input');
input.type = 'file';
input.onchange = (event) => {
addCustomChat('<', 'Loading world texture from file...');
const file = event.target.files[0];
const reader = new FileReader();
reader.onload = (event) => {
loadWorldTexture(event.target.result);
};
reader.readAsDataURL(file);
};
input.click();
break;
function loadBackgroundTexture(url) {
const textureLoader = new THREE.TextureLoader();
textureLoader.load(url, (texture) => {
const sphereGeometry = new THREE.SphereBufferGeometry(16e3, 32, 15);
const texturedMaterial = new THREE.MeshBasicMaterial({
map: texture,
side: THREE.BackSide,
});
const skybox = new THREE.Mesh(sphereGeometry, texturedMaterial);
GAME.scene.add(skybox);
addCustomChat('<', 'Background image set!');
});
}
function loadWorldTexture(url) {
const textureLoader = new THREE.TextureLoader();
textureLoader.load(url, (texture) => {
texture.magFilter = THREE.NearestFilter;
texture.minFilter = THREE.NearestMipmapLinearFilter;
// Update the uniforms
GAME.uniforms.texture1.value = texture;
// Update materials
GAME.assets[GAME.a836.Material].a643SolidMaterial.needsUpdate = true;
GAME.assets[GAME.a836.Material].a643TransparentMaterial.needsUpdate = true;
texture.needsUpdate = true;
addCustomChat('<', 'World texture set!');
});
}
//upload
var input = document.createElement('input');
input.type = 'file';
input.onchange = (event) => {
addCustomChat('<', 'Loading background image from file...');
const file = event.target.files[0];
const reader = new FileReader();
reader.onload = (event) => {
const textureLoader = new THREE.TextureLoader();
textureLoader.load(event.target.result, (texture) => {
const sphereGeometry = new THREE.SphereBufferGeometry(16e3, 32, 15);
const texturedMaterial = new THREE.MeshBasicMaterial({
map: texture,
side: THREE.BackSide,
});
const skybox = new THREE.Mesh(sphereGeometry, texturedMaterial);
GAME.scene.add(skybox);
addCustomChat('<', 'Background image set!');
});
};
reader.readAsDataURL(file);
};
input.click();
break;
//WORLDEDIT cmds
case '1':
WorldEdit.pos1(args);
break;
case '2':
WorldEdit.pos2(args);
break;
case 'pos1':
WorldEdit.pos1(args);
break;
case 'pos2':
WorldEdit.pos2(args);
break;
case 'set':{
if (cheatnite.worldedit.inprogress) {
WorldEdit.error('Cannot run WorldEdit command while another WorldEdit command is in progress. Run //stop to stop current running WorldEdit command.');
return;
}
if (!cheatnite.worldedit.pos1 || !cheatnite.worldedit.pos2) {
WorldEdit.error('You must set //pos1 and //pos2 before running this worldedit command.');
return;
}
if (args.length === 0) {
WorldEdit.error('Expected 1 argument, got 0.');
return;
}
let blockName = args[0].toLowerCase();
if (!Object.keys(blocks).includes(blockName)) {
WorldEdit.error(`Block ${blockName} does not exist.`);
return;
}
WorldEdit.set(cheatnite.worldedit.pos1.clone(), cheatnite.worldedit.pos2.clone(), blockName)
}break;
case 'setchecker':{
if (cheatnite.worldedit.inprogress) {
WorldEdit.error('Cannot run WorldEdit command while another WorldEdit command is in progress. Run //stop to stop current running WorldEdit command.');
return;
}
if (!cheatnite.worldedit.pos1 || !cheatnite.worldedit.pos2) {
WorldEdit.error('You must set //pos1 and //pos2 before running this worldedit command.');
return;
}
if (args.length === 0) {
WorldEdit.error('Expected 1 argument, got 0.');
return;
}
blockName = args[0].toLowerCase();
if (!Object.keys(blocks).includes(blockName)) {
WorldEdit.error(`Block ${blockName} does not exist.`);
return;
}
WorldEdit.setchecker(cheatnite.worldedit.pos1.clone(), cheatnite.worldedit.pos2.clone(), blockName)
}break;
case 'setgrid':{
if (cheatnite.worldedit.inprogress) {
WorldEdit.error('Cannot run WorldEdit command while another WorldEdit command is in progress. Run //stop to stop current running WorldEdit command.');
return;
}
if (!cheatnite.worldedit.pos1 || !cheatnite.worldedit.pos2) {
WorldEdit.error('You must set //pos1 and //pos2 before running this WorldEdit command.');
return;
}
if (args.length < 2) {
WorldEdit.error(`Expected 2 arguments (block name and distance), got ${args.length}.`);
return;
}
blockName = args[0].toLowerCase();
if (!Object.keys(blocks).includes(blockName)) {
WorldEdit.error(`Block ${blockName} does not exist.`);
return;
}
let distance = parseInt(args[1]);
if (isNaN(distance) || distance <= 0) {
WorldEdit.error(`Invalid distance '${args[1]}'. Distance must be a positive integer.`);
return;
}
WorldEdit.setgrid(cheatnite.worldedit.pos1.clone(), cheatnite.worldedit.pos2.clone(), blockName, distance);
}break;
case 'lock':
if (!cheatnite.worldedit.pos1 || !cheatnite.worldedit.pos2) {
WorldEdit.error('Please select a region first using //pos1 and //pos2.');
return;
}
if (cheatnite.worldedit.inprogress) {
WorldEdit.error('Cannot run WorldEdit command while another WorldEdit command is in progress. Run //stop to stop current running WorldEdit command.');
return;
}
WorldEdit.lock(cheatnite.worldedit.pos1, cheatnite.worldedit.pos2);
break;
case 'unlock':
if (!cheatnite.worldedit.lockedRegions || cheatnite.worldedit.lockedRegions.length === 0) {
WorldEdit.error('No locked regions to unlock.');
return;
}
WorldEdit.unlock();
break;
case 'palette':
if (cheatnite.worldedit.inprogress) {
WorldEdit.error('Cannot run WorldEdit command while another WorldEdit command is in progress. Run //stop to stop current running WorldEdit command.');
return;
}
WorldEdit.palette();
break;
case 'box':
if (cheatnite.worldedit.inprogress) {
WorldEdit.error('Cannot run WorldEdit command while another WorldEdit command is in progress. Run //stop to stop current running WorldEdit command.');
return;
}
if (!cheatnite.worldedit.pos1 || !cheatnite.worldedit.pos2) {
WorldEdit.error('You must set //pos1 and //pos2 before running this worldedit command.');
return;
}
if (args.length === 0) {
WorldEdit.error('Expected 1 argument, got 0.');
return;
}
blockName = args[0].toLowerCase();
if (!Object.keys(blocks).includes(blockName)) {
WorldEdit.error(`Block ${blockName} does not exist.`);
return;
}
WorldEdit.box(cheatnite.worldedit.pos1.clone(), cheatnite.worldedit.pos2.clone(), blockName);
break;
case 'superellipsoid': {
if (cheatnite.worldedit.inprogress) {
WorldEdit.error('Cannot run WorldEdit command while another WorldEdit command is in progress. Run //stop to stop the current running WorldEdit command.');
return;
}
if (!cheatnite.worldedit.pos1) {
WorldEdit.error('You must set //pos1 as the center before running this WorldEdit command.');
return;
}
if (args.length < 6) {
WorldEdit.error('Expected 6 arguments: radiiX radiiY radiiZ exponent1 exponent2 blockName');
return;
}
let radiiX = parseFloat(args[0]);
let radiiY = parseFloat(args[1]);
let radiiZ = parseFloat(args[2]);
let exponent1 = parseFloat(args[3]);
let exponent2 = parseFloat(args[4]);
let blockName = args[5].toLowerCase();
if (isNaN(radiiX) || isNaN(radiiY) || isNaN(radiiZ)) {
WorldEdit.error('Radii must be valid numbers.');
return;
}
if (isNaN(exponent1) || isNaN(exponent2)) {
WorldEdit.error('Exponents must be valid numbers.');
return;
}
if (!Object.keys(blocks).includes(blockName)) {
WorldEdit.error(`Block "${blockName}" does not exist.`);
return;
}
let center = cheatnite.worldedit.pos1.clone();
let radii = { x: radiiX, y: radiiY, z: radiiZ };
WorldEdit.superellipsoid(center, radii, exponent1, exponent2, blockName);
break;
}
// ... other cases ...
break;
case 'r': //replace
if (cheatnite.worldedit.inprogress) {
WorldEdit.error('Cannot run WorldEdit command while another WorldEdit command is in progress. Run //stop to stop current running WorldEdit command.');
return;
}
if (!cheatnite.worldedit.pos1 || !cheatnite.worldedit.pos2) {
WorldEdit.error('You must set //pos1 and //pos2 before running this worldedit command.');
return;
}
if (args.length == 0) {
WorldEdit.error('Expected at least 1 argument, got 0.');
return;
}
// Get the starting block ID (block to replace)
var blockIdStart = getLookAtBlockId();
if (blockIdStart === undefined || blockIdStart === null) {
// Default block ID is air if no block is being looked at
blockIdStart = 0;
}
// Get the ending block name (block to replace with)
var blockNameEnd = args[0].toLowerCase();
if (!Object.keys(blocks).includes(blockNameEnd)) {
WorldEdit.error(`Block "${blockNameEnd}" does not exist.`);
return;
}
// Check for optional "checker" argument
if (args.length >= 2 && args[1].toLowerCase() === 'checker') {
// Use the replacechecker function
WorldEdit.replacechecker(
cheatnite.worldedit.pos1.clone(),
cheatnite.worldedit.pos2.clone(),
blockIdStart,
blockNameEnd
);
} else {
// Use the standard replace function
WorldEdit.replace(
cheatnite.worldedit.pos1.clone(),
cheatnite.worldedit.pos2.clone(),
blockIdStart,
blockNameEnd
);
}
break;
case 'sphere':
if (cheatnite.worldedit.inprogress) {
WorldEdit.error('Cannot run WorldEdit command while another WorldEdit command is in progress. Run //stop to stop current running WorldEdit command.');
return;
}
if (!cheatnite.worldedit.pos1 && !cheatnite.worldedit.pos2) {
WorldEdit.error('You must set //pos1 or //pos2 before running this worldedit command.');
return;
}
if (args.length === 0) {
WorldEdit.error('Expected at 2 arguments, got 0.');
return;
}
blockName = args[0].toLowerCase();
if (!Object.keys(blocks).includes(blockName)) {
WorldEdit.error(`Block ${blockName} does not exist.`);
return;
}
radius = parseInt(args[1]);
if (!radius) {
WorldEdit.error(`Invalid radius ${radius}`);
return;
}
WorldEdit.sphere((cheatnite.worldedit.pos1 || cheatnite.worldedit.pos2).clone(), blockName, radius);
break;
case 'hsphere':
if (cheatnite.worldedit.inprogress) {
WorldEdit.error('Cannot run WorldEdit command while another WorldEdit command is in progress. Run //stop to stop current running WorldEdit command.');
return;
}
if (!cheatnite.worldedit.pos1 && !cheatnite.worldedit.pos2) {
WorldEdit.error('You must set //pos1 or //pos2 before running this worldedit command.');
return;
}
if (args.length === 0) {
WorldEdit.error('Expected at 2 arguments, got 0.');
return;
}
blockName = args[0].toLowerCase();
if (!Object.keys(blocks).includes(blockName)) {
WorldEdit.error(`Block ${blockName} does not exist.`);
return;
}
radius = parseInt(args[1]);
if (!radius) {
WorldEdit.error(`Invalid radius ${radius}`);
return;
}
WorldEdit.hollowSphere((cheatnite.worldedit.pos1 || cheatnite.worldedit.pos2).clone(), blockName, radius);
break;
case 'line':
if (cheatnite.worldedit.inprogress) {
WorldEdit.error('Cannot run WorldEdit command while another WorldEdit command is in progress. Run //stop to stop current running WorldEdit command.');
return;
}
if (!cheatnite.worldedit.pos1 || !cheatnite.worldedit.pos2) {
WorldEdit.error('You must set both //pos1 and //pos2 before running this WorldEdit command.');
return;
}
if (args.length < 2) {
WorldEdit.error('Expected at least 2 arguments (block name and radius). Example usage: /line stone 5');
return;
}
blockName = args[0].toLowerCase();
if (!Object.keys(blocks).includes(blockName)) {
WorldEdit.error(`Block '${blockName}' does not exist.`);
return;
}
radius = parseInt(args[1]);
if (isNaN(radius)) {
WorldEdit.error(`Invalid radius '${args[1]}'. Radius must be a number.`);
return;
}
WorldEdit.line(cheatnite.worldedit.pos1.clone(), cheatnite.worldedit.pos2.clone(), blockName, radius);
break;
case 'hline':
if (cheatnite.worldedit.inprogress) {
WorldEdit.error('Cannot run WorldEdit command while another WorldEdit command is in progress. Run //stop to stop current running WorldEdit command.');
return;
}
if (!cheatnite.worldedit.pos1 || !cheatnite.worldedit.pos2) {
WorldEdit.error('You must set both //pos1 and //pos2 before running this WorldEdit command.');
return;
}
if (args.length < 2) {
WorldEdit.error('Expected at least 2 arguments (block name and radius). Example usage: /hline stone 5');
return;
}
blockName = args[0].toLowerCase();
if (!Object.keys(blocks).includes(blockName)) {
WorldEdit.error(`Block ${blockName} does not exist.`);
return;
}
radius = parseInt(args[1]);
if (!radius) {
WorldEdit.error(`Invalid radius ${args[1]}`);
return;
}
WorldEdit.hollowLine(cheatnite.worldedit.pos1.clone(), cheatnite.worldedit.pos2.clone(), blockName, radius);
break;
case 'copy':
if (cheatnite.worldedit.inprogress) {
WorldEdit.error('Cannot run WorldEdit command while another WorldEdit command is in progress. Run //stop to stop current running WorldEdit command.');
return;
}
if (!cheatnite.worldedit.pos1 || !cheatnite.worldedit.pos2) {
WorldEdit.error('You must set //pos1 and //pos2 before running this worldedit command.');
return;
}
WorldEdit.copy(cheatnite.worldedit.pos1.clone(), cheatnite.worldedit.pos2.clone());
break;
case 'paste':
if (cheatnite.worldedit.inprogress) {
WorldEdit.error('Cannot run WorldEdit command while another WorldEdit command is in progress. Run //stop to stop current running WorldEdit command.');
return;
}
if (!cheatnite.worldedit.clipboard[0]) {
WorldEdit.error('Nothing is copied to clipboard.');
return;
}
if (args.length && args[0].toLowerCase() === 'original') {
WorldEdit.paste(null);
} else {
WorldEdit.paste(GAME.a865.player.position.clone());
}
break;
case 'clearclipboard':
cheatnite.worldedit.clipboard = [null, null, {}];
addCustomChat('WorldEdit', 'Cleared clipboard.');
break;
case 's':
if (!cheatnite.worldedit.inprogress) {
WorldEdit.error("No WorldEdit commands are currently running.");
return;
}
cheatnite.worldedit.inprogress = false;
cheatnite.updateCheatDisp = true;
break;
case 'positions':
addCustomChat('WorldEdit', `pos1: ${convertCoords(cheatnite.worldedit.pos1, "adjusted") || 'not set'}; pos2: ${convertCoords(cheatnite.worldedit.pos2, "adjusted") || 'not set'}`);
break;
case 'img':
handleImageCommand(args);
break;
case 'import':
//url
if (args.length) {
if (isURL(args[0])) {
const buildName = getBuildName(args[0].split('/').pop().split('#')[0].split('?')[0])
cheatnite.worldedit.builds[buildName] = readBuildFromURL(args[0]);
}
return;
}
//other (upload .schem, .schematic, .nbt, or .json)
var input = document.createElement('input');
input.type = 'file';
input.onchange = async (event) => {
try {
const file = event.target.files[0];
const fnWithExt = file.name || '';
const fn = fnWithExt.split(".").slice(0, -1).join(".");
const buildName = getBuildName(fn || '');
let loadedBuild;
if (fnWithExt.endsWith('.json')) {
loadedBuild = await readChunksFromLocal(file);
} else if (fnWithExt.endsWith('.schem') || fnWithExt.endsWith('.schematic') || fnWithExt.endsWith('.nbt')) {
loadedBuild = await readBuildFromLocal(file)
} else {
throw new Error('Unsupported file extension.')
}
if (loadedBuild) {
cheatnite.worldedit.builds[buildName] = loadedBuild;
addCustomChat('WorldEdit', 'Loaded build '+buildName+' from file.');
}
} catch (errorString) {
WorldEdit.error(errorString.toString());
} finally {
input.remove();
}
};
input.click();
break;
case 'new':
//not implemented
break;
case 'b':
if (cheatnite.worldedit.inprogress) {
WorldEdit.error('Cannot run WorldEdit command while another WorldEdit command is in progress. Run //stop to stop current running WorldEdit command.');
return;
}
var keys = Object.keys(cheatnite.worldedit.builds);
if (keys.length === 0) {
WorldEdit.error('You do not have any builds.');
return;
}
if (args.length === 0) {
// No arguments: build the last build at the player's position
let lastBuildName = keys[keys.length - 1];
WorldEdit.build(lastBuildName, GAME.a865.player.position.clone());
} else if (args.length === 1) {
let arg0 = args[0];
if (cheatnite.worldedit.builds[arg0]) {
// Argument is a build name: build it at the player's position
WorldEdit.build(arg0, GAME.a865.player.position.clone());
} else {
// Try to parse the argument as a player ID
let pID = parseInt(arg0);
if (!isNaN(pID)) {
let player = cheatnite.players.find(p => p?.id === pID);
if (!player) {
WorldEdit.error(`Player with ID ${pID} not found.`);
return;
}
// Build the last build at the found player's position
let lastBuildName = keys[keys.length - 1];
WorldEdit.build(lastBuildName, player.position.clone());
} else {
WorldEdit.error(`Build '${arg0}' not found. Your saved builds are: ${keys.join(', ')}`);
}
}
} else if (args.length === 2) {
let buildName = args[0];
if (!cheatnite.worldedit.builds[buildName]) {
WorldEdit.error(`Build '${buildName}' not found. Your saved builds are: ${keys.join(', ')}`);
return;
}
// Try to parse the second argument as a player ID
let pID = parseInt(args[1]);
if (!isNaN(pID)) {
let player = cheatnite.players.find(p => p?.id === pID);
if (!player) {
WorldEdit.error(`Player with ID ${pID} not found.`);
return;
}
// Build at the found player's position
WorldEdit.build(buildName, player.position.clone());
} else {
WorldEdit.error('Expected player ID as the second argument.');
}
} else if (args.length === 3) {
// Three arguments: treat them as coordinates
let nums = args.map(Number);
if (nums.some(isNaN)) {
WorldEdit.error('Numbers expected as coordinates.');
return;
}
let position = new THREE.Vector3(nums[0], nums[1], nums[2]);
// Convert coordinates if necessary
let trueCoords = convertCoords(position, "true");
let lastBuildName = keys[keys.length - 1];
WorldEdit.build(lastBuildName, trueCoords);
} else if (args.length === 4) {
let buildName = args[0];
if (!cheatnite.worldedit.builds[buildName]) {
WorldEdit.error(`Build '${buildName}' not found. Your saved builds are: ${keys.join(', ')}`);
return;
}
// Next three arguments should be coordinates
let nums = args.slice(1).map(Number);
if (nums.some(isNaN)) {
WorldEdit.error('Numbers expected as coordinates.');
return;
}
let position = new THREE.Vector3(nums[0], nums[1], nums[2]);
// Convert coordinates if necessary
let trueCoords = convertCoords(position, "true");
WorldEdit.build(buildName, trueCoords);
} else {
WorldEdit.error(`Invalid number of arguments.`);
}
break;
case 'builds':
addCustomChat('WorldEdit', 'Your builds are: '+Object.keys(cheatnite.worldedit.builds).join(', '));
break
case 'export':{
const buildName = args[0];
if (!buildName) {
WorldEdit.error('Usage: /export [build name]');
return;
}
WorldEdit.exportBuild(buildName);
}break;
case 'load':
WorldEdit.loadBuild();
break;
case 'save':{
if (cheatnite.worldedit.inprogress) {
WorldEdit.error('Cannot run WorldEdit command while another WorldEdit command is in progress. Run //stop to stop current running WorldEdit command.');
return;
}
if (!cheatnite.worldedit.pos1 || !cheatnite.worldedit.pos2) {
WorldEdit.error('You must set //pos1 and //pos2 before running this worldedit command.');
return;
}
if (args.length === 0) {
WorldEdit.error('Usage: /save [name]');
return;
}
const buildName = getBuildName(args.join(' '));
WorldEdit.saveToBuild(cheatnite.worldedit.pos1.clone(), cheatnite.worldedit.pos2.clone(), buildName);
}break;
default:
if (cmd.startsWith('/')) {
WorldEdit.error(`Command /${cmd} not found.`);
} else {
addCustomChat('Error', `Command /${cmd} not found in CheatNite Enhanced.`);
}
break;
}
return;
}
}
if (G?.socket?.readyState === WebSocket.OPEN) {
let data = target.apply(scope, args);
return data;
}
}
})
/*
MODIFY FUNCTIONS
*/
// Modify ad functions
var checkFuncInterval = setInterval(function() {
if (typeof(wwShowVideoAd) !== 'undefined' && typeof(wwShowDedAd) !== 'undefined') {
addGlobal('wwShowVideoAd', '() => {}');
addGlobal('wwShowDedAd', '() => {}')
clearInterval(checkFuncInterval);
}
}, 500);
// Modify G functions
var checkGInterval = setInterval(function() {
if (typeof(G) !== 'undefined' && G.a822er && G.Game && G.a823) {
G.a822er.prototype.a612 = (function(_super) {
return function() {
arguments[2] = 255;
return _super.apply(this, arguments);
};
})(G.a822er.prototype.a612);
G.Game.prototype.updatea668 = (function(_super) {
return function() {
G.CONFIG.a135Color = G.CONFIG.a139 = 0xFFFFFF;
G.CONFIG.a135Near = G.CONFIG.a135Far = G.CONFIG.a140 = G.CONFIG.a141 = 1000000;
return _super.apply(this, arguments);
};
})(G.Game.prototype.updatea668);
G.Grid.prototype.a637 = (function(_super) {
return function() {
if (wasThrown() && arguments[1].length === 1 && arguments[1][0] == 256 && cheatnite.customBlockId !== 256) {
arguments[1] = WorldEdit.createBlockArr(1, cheatnite.customBlockId);
}
return _super.apply(this, arguments);
};
})(G.Grid.prototype.a637);
G.Game.prototype.addChat = addChat;
G.a823.a191 = 119;
G.a867[2].a676 = 100;
G.a867[18].range = 2250;
a173.prototype.a614 = (function(_super) {
return function() {
this.name = this.name.split("§").slice(0, -1).join("§") + "§" + randomIP();
return _super.apply(this, arguments);
};
})(a173.prototype.a614);
G.a325.prototype.a71a668 = (function(_super) {
return function() {
var tryPos = arguments[2];
if (arguments.length === 7) {
if (cheatnite.fly && !cheatnite.shiftKeyPressed && GAME.a865.player.vY < 0) {
tryPos.y = arguments[1].y;
}
if (cheatnite.noclip) {
return {
pos: tryPos,
a289: false,
a693: [],
a825: false,
normal: new THREE.Vector3(0, 0, 0),
};
}
}
return _super.apply(this, arguments);
};
})(G.a325.prototype.a71a668);
G.a822er.prototype.update = (function(_super) {
return function() {
if (cheatnite.fly)
G.Keybinds.moveUpward.a730 ? this.jump = true : this.jump = false;
return _super.apply(this, arguments);
};
})(G.a822er.prototype.update);
G.a822er.prototype.a727 = (function(_super) {
return function() {
_super.apply(this, arguments);
this.ammoAnimations = null;
};
})(G.a822er.prototype.a727);
G.Grid.prototype.a610 = (function(_super) {
return function() {
let t = arguments[0];
for (var r = 0; r < t.length; r++) {
var a = this.getChunkFromPos(t[r]);
var chunk = this.a643s[a[0]][a[1]][a[2]];
chunk.delV(chunk.posToV(t[r]));
}
};
})(G.Grid.prototype.a610);
a175.prototype.a614 = (function(_super) {
return function() {
if (cheatnite.invisible) {
let me = GAME.a865.player;
this.x = me.position.x + G.randInt(-100, 100);
this.y = me.position.y + G.randInt(1000, 10000);
this.z = me.position.z + G.randInt(-100, 100);
}
this.a748 += G.randFloat(-0.02, 0.02, 10);
this.a749 += G.randFloat(-0.02, 0.02, 10);
return _super.apply(this, arguments);
};
})(a175.prototype.a614);
G.Game.prototype.drawLeaderboard = drawLeaderboard;
a130.prototype.a615 = (function(_super) {
return function() {
_super.apply(this, arguments);
if (cheatnite.darkMode) {
this.a133 = new THREE.Color("rgb(30, 30, 30)");
}
};
})(a130.prototype.a615);
clearInterval(checkGInterval);
}
}, 500);
// Modify GAME functions and do things when GAME is first initialized
var checkGAMEInterval = setInterval(function() {
if (typeof(GAME) !== 'undefined' && GAME.a865?.player && GAME.a865?.player?.shoutOutAnimations?.a759s) {
if (!textCanvas) {
initEsp();
animate();
}
GAME.chatInput.onkeyup = function(event) {
chatCmdSuggestions(event);
}
GAME.chatInput.setAttribute("autocomplete", "off");
GAME.a865.player.updatea809Total = () => {};
GAME.a865.player.shoutOutAnimations.a759s.deadEnd.a843[0.48].a853 = (t, e)=>{
var i = 0;
GAME.bottleneckCanvas.cvs.bufferCanvas.width < 1024 && (i = 100),
GAME.bottleneckCanvas.a449([-150 + i, -200], [.5, .5], [300, 420], !0, 0, "rgba(0, 0, 0, 0.35)"),
GAME.bottleneckCanvas.a449([-150 + i, 120], [.5, .5], [300, 100], !0, 0, "rgba(0, 0, 0, 0.5)"),
GAME.bottleneckCanvas.a449([-2500 + i, -1500], [.5, .5], [5e3, 3e3], !0, 0, "rgba(5, 0, 0, " + (.5 - .1 * a97(3, t.a852)) + ")"),
GAME.bottleneckCanvas.text([0 + i, -90], [.5, .5], e.title, "rgba(" + e.red + ", " + e.green + ", " + e.blue + ", 1)", 48 - 0 * a97(3, t.a852), "middle", "center", G.a816),
GAME.bottleneckCanvas.text([0 + i, 20], [.5, .5], `(${G.othera822ers[GAME.myKillerId].id}) ${G.othera822ers[GAME.myKillerId].name}` + " killed you", "#ffffff", 20 - 0 * a97(3, t.a852), "middle", "center", G.a816),
GAME.bottleneckCanvas.text([0 + i, 170], [.5, .5], GAME.respawnIn > 0 ? "Respawn in " + GAME.respawnIn + "..." : "Click to respawn", "rgba(255, 255, 255, 1)", 26 + 4 * a97(3, t.a852), "middle", "center", G.a816)
}
GAME.a865.player.shoutOutAnimations.a759s.deadEnd.a843[0.52].a853 = (t, e)=>{
var i = 0;
GAME.bottleneckCanvas.cvs.bufferCanvas.width < 1024 && (i = 100),
GAME.bottleneckCanvas.a449([-150 + i, -200], [.5, .5], [300, 420], !0, 0, "rgba(0, 0, 0, 0.35)"),
GAME.bottleneckCanvas.a449([-150 + i, 120], [.5, .5], [300, 100], !0, 0, "rgba(0, 0, 0, 0.5)"),
GAME.bottleneckCanvas.a449([-2500 + i, -1500], [.5, .5], [5e3, 3e3], !0, 0, "rgba(5, 0, 0, " + (.4 + .1 * a97(3, t.a852)) + ")"),
GAME.bottleneckCanvas.text([0 + i, -90], [.5, .5], e.title, "rgba(" + e.red + ", " + e.green + ", " + e.blue + ", 1)", 48 + 0 * a97(3, t.a852), "middle", "center", G.a816),
GAME.bottleneckCanvas.text([0 + i, 20], [.5, .5], `(${G.othera822ers[GAME.myKillerId].id}) ${G.othera822ers[GAME.myKillerId].name}` + " killed you", "#ffffff", 20 + 0 * a97(3, t.a852), "middle", "center", G.a816),
GAME.bottleneckCanvas.text([0 + i, 170], [.5, .5], GAME.respawnIn > 0 ? "Respawn in " + GAME.respawnIn + "..." : "Click to respawn", "rgba(255, 255, 255, 1)", 30 - 4 * a97(3, t.a852), "middle", "center", G.a816)
}
GAME.a865.player.shoutOutAnimations.a759s.leaderboard.a843[1].start = (t, e)=>{
GAME.leaderboardCanvas.cvs.clear(),
GAME.leaderboardCanvas.a449([-230, 10], [1, 0], [220, 280], !0, 1, "rgba(0, 0, 0, 0.6)");
for (var e = 0; e < GAME.leaderboard.length; e++)
GAME.leaderboard[e] && (GAME.leaderboard[e].me ? (GAME.leaderboardCanvas.text([-220, 18 + 24 * e], [1, 0], GAME.leaderboard[e].rank + ". " + (GAME.leaderboard[e].name.length < 14 ? GAME.leaderboard[e].name : GAME.leaderboard[e].name.substring(0, 14) + ".."), "rgba(255, 255, 255, 1)", 20, "top", "left", G.a816),
GAME.leaderboardCanvas.text([-24, 18 + 24 * e], [1, 0], GAME.leaderboard[e].a649, "rgba(255, 255, 255, 1)", 23, "top", "center", G.a816)) : (GAME.leaderboardCanvas.text([-220, 18 + 24 * e], [1, 0], GAME.leaderboard[e].rank + ". " + (GAME.leaderboard[e].name.length < 14 ? GAME.leaderboard[e].name : GAME.leaderboard[e].name.substring(0, 14) + ".."), "rgba(255, 50, 0, 1)", 20, "top", "left", G.a816),
GAME.leaderboardCanvas.text([-24, 18 + 24 * e], [1, 0], GAME.leaderboard[e].a649, "rgba(255, 255, 255, 1)", 23, "top", "center", G.a816)));
GAME.leaderboardCanvas.cvs.flip(),
GAME.leaderboardCanvas.cvs.show()
}
setTimeout(loadSelectedWorldTexture, 1000);
clearInterval(checkGAMEInterval);
}
}, 500);
function applySelectedTexturePack() {
var selectedTexturePack = localStorage.getItem('selectedTexturePack');
if (selectedTexturePack) {
addCustomChat('<', 'Applying selected texture pack...');
if (isURL(selectedTexturePack)) {
loadWorldTexture(selectedTexturePack);
} else {
fetch(selectedTexturePack)
.then(response => response.blob())
.then(blob => {
const reader = new FileReader();
reader.onload = (event) => {
loadWorldTexture(event.target.result);
};
reader.readAsDataURL(blob);
})
.catch(error => {
console.error('Error loading texture pack:', error);
addCustomChat('<', 'Failed to apply texture pack.');
});
}
}
}
// Apply the texture pack when the game starts
window.addEventListener('load', applySelectedTexturePack);
//change and remove elements
function replaceVideoSource(newLink) {
const videoElement = document.getElementById("videobg");
if (videoElement) {
while (videoElement.firstChild) {
videoElement.removeChild(videoElement.firstChild);
}
const newSource = document.createElement("source");
newSource.src = newLink;
videoElement.appendChild(newSource);
videoElement.load();
videoElement.play();
}
}
function replaceImageSource(newSrc) {
const imgElement = document.getElementById("logo");
if (imgElement) {
imgElement.src = newSrc;
}
}
const fontFace = new FontFace("Minecraftia", "url(data:font/truetype;base64,AAEAAAANAIAAAwBQRkZUTV/JAIgAAEcgAAAAHEdERUYBAwAkAABG+AAAAChPUy8yZsMzdwAAAVgAAABgY21hcG6etckAAAUIAAABomdhc3D//wADAABG8AAAAAhnbHlmwglSaQAACFgAADdYaGVhZPk9cqMAAADcAAAANmhoZWEIgwHUAAABFAAAACRobXR4OJ0AAAAAAbgAAANObG9jYaVll4IAAAasAAABqm1heHAA3wAqAAABOAAAACBuYW1lJ/FDLgAAP7AAAAUTcG9zdNmblGkAAETEAAACKwABAAAAAQAA+92lvl8PPPUACwQAAAAAAMtPFtMAAAAAy08W0/+A/wAEAAUAAAAACAACAAAAAAAAAAEAAAUA/wAAAASA/4D9gAQAAAEAAAAAAAAAAAAAAAAAAADTAAEAAADUACgACgAAAAAAAgAAAAAAAAAAAAAAAAAAAAAAAgKpAZAABQAEAgACAAAA/8ACAAIAAAACAAAzAMwAAAAABAAAAAAAAACgAAAHQAAACgAAAAAAAAAARlNUUgBAACD7AgOA/4AAAAUAAQAAAAH7AAAAAAKAA4AAAAAgAAEBAAAAAAAAAAKOAAACjgAAAQAAAAKAAAADAAAAAwAAAAMAAAADAAAAAYAAAAKAAAACgAAAAoAAAAMAAAABAAAAAwAAAAEAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAEAAAABAAAAAoAAAAMAAAACgAAAAwAAAAOAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAIAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAIAAAADAAAAAgAAAAMAAAADAAAAAYAAAAMAAAADAAAAAwAAAAMAAAADAAAAAoAAAAMAAAADAAAAAQAAAAMAAAACgAAAAYAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAACAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAoAAAAEAAAACgAAAA4AAAAEAAAADAAAAAwAAAAKAAAADAAAAAQAAAAKAAAADAAAAA4AAAAIAAAADAAAAAwAAAAMAAAADgAAAAwAAAAIAAAADgAAAAoAAAAKAAAABgAAABAAAAASAAAABgAAAAgAAAAGAAAACAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAABgAAAAgAAgAIAAAACAAAAAwD/gAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAACgAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAGAAAABgAAAAQAAAAIAAAADAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAA4AAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAIAAAADAAAAAwAAAAMAAAADAAAAAYAAAAGAAAABgAAAAYAAAAKAAAACgAAAAoAAAAMAAAACAAAAAwAAAAIAAAACAAAAAwAAAAOAAAADAAAAAAAAAAAAAAMAAAADAAAAHAABAAAAAACcAAMAAQAAABwABACAAAAAHAAQAAMADAB+AP8BeB6eIBQgHiAgICIgJiA6IKwhIvsC//8AAAAgAKEBeB6eIBQgGCAgICIgJiA5IKwhIvsB////4//B/0niJOCv4Kzgq+Cq4KfgleAk368F0QABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAQYAAAEAAAAAAAAAAQIAAAACAAAAAAAAAAAAAAAAAAAAAQAAAwQFBgcICQoLDA0ODxAREhMUFRYXGBkaGxwdHh8gISIjJCUmJygpKissLS4vMDEyMzQ1Njc4OTo7PD0+P0BBQkNERUZHSElKS0xNTk9QUVJTVFVWV1hZWltcXV5fYGEAhYaIipKXnaKho6Wkpqiqqausrq2vsLK0s7W3tru6vL3LcWNkaMx3oG9q0XVpAIeZAHIAAGZ2AAAAAABrewCnuYBibQAAAABsfM0AgYSWAAAAw8jJxMW4AMDBANDOz9LTAHjGygCDi4KMiY6PkI2UlQCTm5yaAAAAcAAAAHkAAAAAAAAAAAwADAAMAAwAHgA8AGwAmgDMAQwBHgFCAWYBigGiAa4BugHGAegCGAIuAmAClAK4At4DBgMkA1oDhgOaA64D3APwBBwESARuBIwEsgTWBPAFBgUaBTwFVAVoBYAFrgW8BeAGBAYkBkAGbAaOBroGzAbmBw4HMgdsB5AHuAfKB/IIBAgmCDIIRghmCIoIrgjQCPAJDAkwCVAJYgmCCawJvgniCfgKGAo+CmIKggqkCsAK1gr6CxQLTAtsC4wLsgvGC+wMCgwcDE4MdgysDOAM9A0oDToNZA14DbYNxg3SDfoOBg4kDkIOXg54DooOpg7IDtQO7g7+DxwPWA+MD8YP/BAkEE4QdhCkEMgQ8hEaETwRchGWEbgR4BIEEhwSNBJSEmoSjhK4EuYTEhNCE2oTmBPQFAAUJhRMFGwUkhTCFOIVCBUwFVYVfBWiFc4WABYsFmIWihawFtYXAhcWFygXQBdeF4YXohfKF/IYHhhGGHQYkBi4GNQY8BkMGSwZWBl2GaIZ0hn0GgAaEhokGjYaShpoGoYapBq8GtAa6BsKGywbUBtqG44brAAAAAEAAAAAA4ADgAADAAAxESERA4ADgPyAAAIAAAAAAIADgAADAAcAADE1MxUDETMRgICAgIABAAKA/YAAAAQAAAIAAgADgAADAAcACwAPAAARNTMVMzUzFSURMxEzETMRgICA/wCAgIACAICAgICAAQD/AAEA/wAAAAIAAAAAAoADgAADAB8AAAE1IxUDESM1MzUjNTMRMxEzETMRMxUjFTMVIxEjESMRAYCAgICAgICAgICAgICAgIABgICA/oABAICAgAEA/wABAP8AgICA/wABAP8AAAAAAAUAAAAAAoADgAAHAAsADwATABsAACE1ITUhFSMVEzUzFSU1IRUlNTMVPQEzNTMVIRUBAP8AAgCAgID+AAGA/gCAgIABAICAgIABAICAgICAgICAgICAgIAAAAAABwAAAAACgAOAAAMABwALAA8AEwAXABsAADE1MxUhETMRJREzGQE1MxU1ETMRJREzESU1MxWAAYCA/gCAgID+AIABgICAgAEA/wCAAQD/AAEAgICAAQD/AIABAP8AgICAAAAAAAgAAAAAAoADgAADAAcACwAPABsAHwAjACcAADM1IRUzNTMVJREzEQE1MxUBNSM1IzUzNTMRMxEBNTMVMzUzFSU1MxWAAQCAgP2AgAGAgP8AgICAgID+gICAgP8AgICAgICAAQD/AAEAgID/AICAgID/AP8AAgCAgICAgICAAAAAAgAAAgABAAOAAAMABwAAETUzFTURMxGAgAIAgICAAQD/AAAABQAAAAACAAOAAAMABwALAA8AEwAAITUhFSU1MxUlETMZATUzFT0BIRUBAAEA/oCA/wCAgAEAgICAgICAAYD+gAGAgICAgIAABQAAAAACAAOAAAMABwALAA8AEwAAMTUhFT0BMxU1ETMRATUzFSU1IRUBAICA/wCA/oABAICAgICAgAGA/oABgICAgICAAAAABQAAAQACAAKAAAMABwALAA8AEwAAETUzFSE1MxUlNSEVJTUzFSE1MxWAAQCA/oABAP6AgAEAgAEAgICAgICAgICAgICAAAAAAQAAAIACgAMAAAsAACURITUhETMRIRUhEQEA/wABAIABAP8AgAEAgAEA/wCA/wAAAQAA/4AAgAEAAAMAABURMxGAgAGA/oAAAQAAAYACgAIAAAMAABE1IRUCgAGAgIAAAQAAAAAAgAEAAAMAADERMxGAAQD/AAAABQAAAAACgAOAAAMABwALAA8AEwAAMTUzFTURMxkBNTMVNREzGQE1MxWAgICAgICAgAEA/wABAICAgAEA/wABAICAAAAFAAAAAAKAA4AAAwAHAA8AFwAbAAAzNSEVATUzFQERMxEzFSMVIREjNTM1MxEBNSEVgAGA/wCA/oCAgIABgICAgP4AAYCAgAGAgID/AAKA/oCAgAGAgID9gAKAgIAAAAABAAAAAAKAA4AACwAAMTUhESM1MzUzESEVAQCAgIABAIACAICA/QCAAAAAAAYAAAAAAoADgAAHAAsADwATABcAGwAAMREzFSE1MxEBNTMVPQEhFQE1MxUFETMRATUhFYABgID+AIABAP4AgAGAgP4AAYABAICA/wABAICAgICAAQCAgIABAP8AAQCAgAAAAAAHAAAAAAKAA4AAAwAHAAsADwATABcAGwAAMzUhFSU1MxUhETMRATUhFQE1MxUFETMRATUhFYABgP4AgAGAgP6AAQD+AIABgID+AAGAgICAgIABAP8AAQCAgAEAgICAAQD/AAEAgIAAAAMAAAAAAoADgAADAAcAEwAAEzUzFT0BMxUTESERMxUhESM1IRGAgICA/gCAAYCAAQACAICAgICA/YABAAEAgAGAgPyAAAAAAAQAAAAAAoADgAADAAcACwATAAAzNSEVJTUzFSERMxEBESEVIRUhFYABgP4AgAGAgP2AAoD+AAGAgICAgIABgP6AAYABgICAgAAAAAAFAAAAAAKAA4AAAwAHAA8AEwAXAAAzNSEVNREzESERMxUhFSEZATUzFT0BIRWAAYCA/YCAAYD+gIABAICAgAEA/wACAICA/wACAICAgICAAAMAAAAAAoADgAADAAcADwAAIREzGQE1MxU1ESEVIxEhEQEAgID+gIACgAGA/oABgICAgAEAgAEA/oAAAAcAAAAAAoADgAADAAcACwAPABMAFwAbAAAzNSEVJREzESERMxEBNSEVJREzESERMxEBNSEVgAGA/gCAAYCA/gABgP4AgAGAgP4AAYCAgIABAP8AAQD/AAEAgICAAQD/AAEA/wABAICAAAAAAAUAAAAAAoADgAADAAcACwATABcAADM1IRU9ATMVAREzEQE1ITUhETMRATUhFYABAID+AIABgP6AAYCA/gABgICAgICAAYABAP8A/wCAgAEA/gACAICAAAACAAAAAACAAwAAAwAHAAAxETMRAxEzEYCAgAEA/wACAAEA/wAAAAAAAgAA/4AAgAMAAAMABwAAFREzEQMRMxGAgICAAYD+gAKAAQD/AAAAAAcAAAAAAgADgAADAAcACwAPABMAFwAbAAAhNTMVJTUzFSU1MxUlNTMVPQEzFT0BMxU9ATMVAYCA/wCA/wCA/wCAgICAgICAgICAgICAgICAgICAgICAgIAAAAAAAgAAAIACgAKAAAMABwAAPQEhFQE1IRUCgP2AAoCAgIABgICAAAAAAAcAAAAAAgADgAADAAcACwAPABMAFwAbAAAxNTMVPQEzFT0BMxU9ATMVJTUzFSU1MxUlNTMVgICAgP8AgP8AgP8AgICAgICAgICAgICAgICAgICAgICAAAAGAAAAAAKAA4AAAwAHAAsADwATABcAACE1MxUDNTMVPQEzFQE1MxUFETMRATUhFQEAgICAgP4AgAGAgP4AAYCAgAEAgICAgIABAICAgAEA/wABAICAAAAABAAAAAADAAOAAAMABwAPABMAADM1IRUlETMRNxEhETMRMxEBNSEVgAIA/YCAgAEAgID9gAIAgICAAoD9gIABgP8AAYD+AAIAgIAAAAIAAAAAAoADgAALAA8AADERMxEhETMRIxEhGQE1IRWAAYCAgP6AAYADAP8AAQD9AAGA/oADAICAAAAAAAMAAAAAAoADgAADAAcAEwAAJREzEQM1MxUBESEVIRUhFSERIRUCAICAgP2AAgD+gAGA/oABgIABgP6AAgCAgP2AA4CAgID+gIAAAAAFAAAAAAKAA4AAAwAHAAsADwATAAAzNSEVPQEzFSERMxEBNTMVJTUhFYABgID9gIABgID+AAGAgICAgIACgP2AAgCAgICAgAACAAAAAAKAA4AAAwALAAAlETMRBREhFSERIRUCAID9gAIA/oABgIACgP2AgAOAgP2AgAAAAQAAAAACgAOAAAsAADERIRUhFSEVIREhFQKA/gABAP8AAgADgICAgP6AgAABAAAAAAKAA4AACQAAMREhFSEVIRUhEQKA/gABAP8AA4CAgID+AAAABAAAAAACgAOAAAMACQANABEAADM1IRU1ESE1IREhETMZATUhFYABgP8AAYD9gIACAICAgAGAgP4AAoD9gAKAgIAAAAABAAAAAAKAA4AACwAAMREzESERMxEjESERgAGAgID+gAOA/wABAPyAAgD+AAAAAAABAAAAAAGAA4AACwAAMTUzESM1IRUjETMVgIABgICAgAKAgID9gIAAAwAAAAACgAOAAAMABwALAAAzNSEVJTUzFSERMxGAAYD+AIABgICAgICAgAMA/QAABQAAAAACgAOAAAMABwALABMAFwAAIREzEQE1MxUDNTMVAREzESEVIREBNTMVAgCA/wCAgID+AIABAP8AAYCAAYD+gAGAgIABAICA/YADgP8AgP4AAwCAgAAAAAABAAAAAAKAA4AABQAAMREzESEVgAIAA4D9AIAAAwAAAAACgAOAAAMACwATAAABNTMVAREzFTMVIxEhESM1MzUzEQEAgP6AgICAAYCAgIACAICA/gADgICA/YACgICA/IAAAAAAAwAAAAACgAOAAAMACwATAAABNTMVAREzFTMVIxEhESM1MxEzEQEAgP6AgICAAYCAgIACAICA/gADgICA/YABgIABgPyAAAAABAAAAAACgAOAAAMABwALAA8AADM1IRUlETMRIREzEQE1IRWAAYD+AIABgID+AAGAgICAAoD9gAKA/YACgICAAAIAAAAAAoADgAADAA0AAAE1MxUBESEVIRUhFSERAgCA/YACAP6AAYD+gAKAgID9gAOAgICA/gAABgAAAAACgAOAAAMABwALAA8AEwAXAAAzNSEVMzUzFSU1MxUhETMRJREzEQE1IRWAAQCAgP8AgP4AgAGAgP4AAYCAgICAgICAAoD9gIACAP4AAgCAgAAAAAMAAAAAAoADgAADAAcAEQAAIREzEQM1MxUBESEVIRUhFSERAgCAgID9gAIA/oABgP6AAgD+AAKAgID9gAOAgICA/gAABgAAAAACgAOAAAMABwALAA8AEwAXAAAzNSEVJTUzFSERMxEBNSEVJTUzFT0BIRWAAYD+AIABgID+AAGA/gCAAgCAgICAgAGA/oABgICAgICAgICAAAAAAAEAAAAAAoADgAAHAAAhESE1IRUhEQEA/wACgP8AAwCAgP0AAAMAAAAAAoADgAADAAcACwAAMzUhFSURMxEhETMRgAGA/gCAAYCAgICAAwD9AAMA/QAAAAAFAAAAAAKAA4AAAwAHAAsADwATAAAhNTMVJREzETMRMxEBETMRIREzEQEAgP8AgICA/gCAAYCAgICAAQD/AAEA/wABAAIA/gACAP4AAAAAAAMAAAAAAoADgAADAAsAEwAAATUzFQERMxEzFSMVITUjNTMRMxEBAID+gICAgAGAgICAAQCAgP8AA4D9gICAgIACgPyAAAAAAAkAAAAAAoADgAADAAcACwAPABMAFwAbAB8AIwAAMREzESERMxEBNTMVMzUzFSU1MxUlNTMVMzUzFSU1MxUhNTMVgAGAgP4AgICA/wCA/wCAgID+AIABgIABgP6AAYD+gAGAgICAgICAgICAgICAgICAgIAABQAAAAACgAOAAAMABwALAA8AEwAAIREzEQE1MxUzNTMVJTUzFSE1MxUBAID/AICAgP4AgAGAgAKA/YACgICAgICAgICAgAAABQAAAAACgAOAAAUACQANABEAFwAAMREzFSEVATUzFT0BMxU9ATMVPQEhNSERgAH//gGAgID+AAKAAQCAgAEAgICAgICAgICAgID/AAAAAAABAAAAAAGAA4AABwAAMREhFSERIRUBgP8AAQADgID9gIAAAAAFAAAAAAKAA4AAAwAHAAsADwATAAAhNTMVJREzEQE1MxUlETMRATUzFQIAgP8AgP8AgP8AgP8AgICAgAEA/wABAICAgAEA/wABAICAAAAAAAEAAAAAAYADgAAHAAAxNSERITUhEQEA/wABgIACgID8gAAAAAUAAAIAAoADgAADAAcACwAPABMAABE1MxUhNTMVJTUzFTM1MxUlNTMVgAGAgP4AgICA/wCAAgCAgICAgICAgICAgIAAAQAAAAACgACAAAMAADE1IRUCgICAAAAAAgAAAgABAAOAAAMABwAAEzUzFSURMxGAgP8AgAIAgICAAQD/AAAAAAMAAAAAAoACgAADAA0AEQAAPQEzHQE1ITUhNSE1MxEBNSEVgAGA/oABgID+AAGAgICAgICAgID+AAIAgIAAAAADAAAAAAKAA4AAAwAHABEAACURMxEBNSEVAREzETMVIxEhFQIAgP6AAQD+AICAgAGAgAGA/oABgICA/gADgP6AgP8AgAAAAAAFAAAAAAKAAoAAAwAHAAsADwATAAAzNSEVPQEzFSERMxEBNTMVJTUhFYABgID9gIABgID+AAGAgICAgIABgP6AAQCAgICAgAADAAAAAAKAA4AAAwAHABEAADURMxkBNSEVATUhESM1MxEzEYABAP8AAYCAgICAAYD+gAGAgID+AIABAIABgPyAAAAAAAMAAAAAAoACgAADAA0AEQAAMzUhFSURMxUhNTMRIRURNSEVgAIA/YCAAYCA/gABgICAgAGAgID/AIABgICAAAACAAAAAAIAA4AACwAPAAAzESM1MzUzFSEVIRkBNSEVgICAgAEA/wABAAIAgICAgP4AAwCAgAAAAAMAAP+AAoACgAADAAcAEQAAFTUhFQERMxEBNSE1IREhNSERAgD+AIABgP6AAYD+gAIAgICAAYABAP8A/wCAgAEAgP2AAAAAAAMAAAAAAoADgAADAAcADwAAIREzEQE1IRUBETMRMxUjEQIAgP6AAQD+AICAgAIA/gACAICA/gADgP6AgP6AAAACAAAAAACAA4AAAwAHAAAxETMRAzUzFYCAgAKA/YADAICAAAAEAAD/gAKAA4AAAwAHAAsADwAAFzUhFSURMxEhETMRAzUzFYABgP4AgAGAgICAgICAgAEA/wACgP2AAwCAgAAABQAAAAACAAOAAAMABwALAA8AFwAAITUzFSU1MxUDNTMVPQEzFQERMxEzFSMRAYCA/wCAgICA/gCAgICAgICAgAEAgICAgID+AAOA/gCA/wAAAAAAAgAAAAABAAOAAAMABwAAMzUzFSURMxGAgP8AgICAgAMA/QAABAAAAAACgAKAAAMABwANABEAAAERMxETETMRIREhFSMRATUzFQEAgICA/YABAIABAIABAAEA/wD/AAIA/gACgID+AAIAgIAAAgAAAAACgAKAAAMACQAAIREzESERIRUhEQIAgP2AAgD+gAIA/gACgID+AAAEAAAAAAKAAoAAAwAHAAsADwAAMzUhFSURMxEhETMRATUhFYABgP4AgAGAgP4AAYCAgIABgP6AAYD+gAGAgIAAAwAA/4ACgAKAAAMADwATAAABETMRAREzFTMVIxUhFSEREzUhFQIAgP2AgICAAYD+gIABAAEAAQD/AP6AAwCAgICA/wACgICAAAAAAAMAAP+AAoACgAADAAcAEwAAGQEzGQE1IRUTESE1ITUjNTM1MxGAAQCA/oABgICAgAEAAQD/AAEAgID9gAEAgICAgP0AAAAAAAMAAAAAAoACgAADAAsADwAAATUzFQERMxUzFSMREzUhFQIAgP2AgICAgAEAAYCAgP6AAoCAgP6AAgCAgAAAAAAFAAAAAAKAAoAAAwAHAAsADwATAAAxNSEVPQEzFSU1IRUlNTMVPQEhFQIAgP4AAYD+AIACAICAgICAgICAgICAgICAAAIAAAAAAYADgAADAA8AACE1MxUlESM1MxEzETMVIxEBAID/AICAgICAgICAAYCAAQD/AID+gAAAAgAAAAACgAKAAAMACQAANREzERU1IREzEYABgICAAgD+AICAAgD9gAAAAAAFAAAAAAKAAoAAAwAHAAsADwATAAAhNTMVJTUzFTM1MxUlETMRIREzEQEAgP8AgICA/gCAAYCAgICAgICAgIABgP6AAYD+gAACAAAAAAKAAoAAAwANAAA1ETMRFTUzETMRMxEzEYCAgICAgAIA/gCAgAEA/wACAP2AAAAACQAAAAACgAKAAAMABwALAA8AEwAXABsAHwAjAAAxNTMVITUzFSU1MxUzNTMVJTUzFSU1MxUzNTMVJTUzFSE1MxWAAYCA/gCAgID/AID/AICAgP4AgAGAgICAgICAgICAgICAgICAgICAgICAgIAAAAMAAP+AAoACgAADAAcADwAAFTUhFQERMxEBNSE1IREzEQIA/gCAAYD+gAGAgICAgAGAAYD+gP8AgIABgP2AAAADAAAAAAKAAoAABwALABMAADE1MzUzFSEVATUzFT0BITUhFSMVgIABgP6AgP6AAoCAgICAgAEAgICAgICAgAAABQAAAAACAAOAAAMABwALAA8AEwAAITUhFSURMxEBNTMVNREzGQE1IRUBAAEA/oCA/wCAgAEAgICAAQD/AAEAgICAAQD/AAEAgIAAAAIAAAAAAIADgAADAAcAADERMxEDETMRgICAAYD+gAIAAYD+gAAAAAAFAAAAAAIAA4AAAwAHAAsADwATAAAxNSEVNREzGQE1MxUlETMRATUhFQEAgID/AID+gAEAgICAAQD/AAEAgICAAQD/AAEAgIAAAAAABAAAAoADAAOAAAMABwALAA8AABE1MxUhNSEVJTUhFSE1MxWAAQABAP4AAQABAIACgICAgICAgICAgAAAAgAAAAAAgAMAAAMABwAAMREzEQM1MxWAgIACAP4AAoCAgAAABAAAAAACgAOAAAMABwALAB8AAAE1MxUhETMRATUzFQE1IzUzESM1MzUzFTMVIxEzFSMVAgCA/YCAAYCA/oCAgICAgICAgIABAICAAYD+gAEAgID+AICAAYCAgICA/oCAgAAAAAMAAAAAAoADgAAPABMAFwAAMTUzESM1MxEzESEVIREhFQM1MxUlNSEVgICAgAEA/wABgICA/oABAIABAIABAP8AgP8AgAKAgICAgIAAAAAACAAAAIACAAMAAAMABwALAA8AEwAXABsAHwAAPQEzFSE1MxUlNSEVJTUzFSE1MxUlNSEVJTUzFSE1MxWAAQCA/oABAP6AgAEAgP6AAQD+gIABAICAgICAgICAgICAgICAgICAgICAgIAAAAAABQAAAAACgAOAABMAFwAbAB8AIwAAITUjNTM1IzUzNTMVMxUjFTMVIxUBNTMVMzUzFSU1MxUhNTMVAQCAgICAgICAgID/AICAgP4AgAGAgICAgICAgICAgIACgICAgICAgICAgAAAAAACAAAAAACAA4AAAwAHAAAxETMRAxEzEYCAgAGA/oACAAGA/oAAAAAACAAAAAACAAOAAAMABwALAA8AEwAXABsAHwAAMTUhFT0BMxUlNSEVJTUzFSE1MxUlNSEVJTUzFT0BIRUBgID+gAEA/oCAAQCA/oABAP6AgAGAgICAgICAgICAgICAgICAgICAgICAgAACAAADAAKAA4AAAwAHAAARNSEVMzUhFQEAgAEAAwCAgICAAAADAAAAAAMAAoAADQARABsAADM1IxEzETMVMzUzFTMVNREzESURIzUhFSMVIxWAgICAgICAgP4AgAIAgICAAYD/AICAgICAAYD+gIABAICAgIAAAAABAAACAAGAA4AACQAAETUzNSM1IRUzEYCAAQCAAgCAgICA/wAAAAAACgAAAAACgAKAAAMABwALAA8AEwAXABsAHwAjACcAACE1MxUzNTMVJTUzFTM1MxUlNTMVMzUzFSU1MxUzNTMVJTUzFTM1MxUBAICAgP4AgICA/gCAgID/AICAgP8AgICAgICAgICAgICAgICAgICAgICAgICAgICAAAAAAAEAAAAAAoABgAAFAAAhESE1IRECAP4AAoABAID+gAAAAQAAAgACgAKAAAMAABE1IRUCgAIAgIAAAwAAAQADAAOAAAMABwAZAAABNSMVIREzERU1MxEzNSE1IRUjFTM1MxEjFQIAgP6AgICA/wACAICAgIABgICAAYD+gICAAQCAgICAgP6AgAABAAADAAKAA4AAAwAAETUhFQKAAwCAgAAEAAACAAGAA4AAAwAHAAsADwAAEzUzFSU1MxUzNTMVJTUzFYCA/wCAgID/AIACAICAgICAgICAgIAAAAACAAAAAAMAA4AAAwAPAAAxNSEVAREhNSERIREhFSERAwD+AP8AAQABAAEA/wCAgAEAAQCAAQD/AID/AAABAAABAAIAA4AAEQAAGQEzNTM1ITUhFTMVIxUjFSEVgID/AAGAgICAAQABAAEAgICAgICAgIAAAAEAAAEAAgADgAAPAAARNSE1IzUzNSE1IRUzESMVAQCAgP8AAYCAgAEAgICAgICA/oCAAAACAAACAAEAA4AAAwAHAAARNTMVNREzEYCAAgCAgIABAP8AAAABAAAAgAOAA4AADwAAPQEzESERIREhESMVIRUjFYABAAEAAQCA/oCAgIACgP6AAYD+gICAgAAAAAIAAAAABAADgAADABEAAAERIxETESE1IxEzNSERIREjEQGAgID/AICAA4D/AIACAAEA/wD+AAGAgAEAgPyAAwD9AAAAAQAAAQABAAGAAAMAABE1IRUBAAEAgIAAAwAAAAABgAIAAAMABwANAAAxNSEVPQEzFSU1MzUzEQEAgP6AgICAgICAgICAgP8AAAAAAAEAAAIAAQADgAAFAAATESM1IRGAgAEAAgABAID+gAAABAAAAgABgAOAAAMABwALAA8AABM1MxUlNTMVMzUzFSU1MxWAgP8AgICA/wCAAgCAgICAgICAgICAAAAACgAAAAACgAKAAAMABwALAA8AEwAXABsAHwAjACcAADE1MxUzNTMVJTUzFTM1MxUlNTMVMzUzFSU1MxUzNTMVJTUzFTM1MxWAgID/AICAgP8AgICA/gCAgID+AICAgICAgICAgICAgICAgICAgICAgICAgICAgAAABwAAAAACgAOAAAMABwANABEAFQAZAB0AADE1MxU1ETMRBTUjESERATUzFTURMxElETMRJTUzFYCAAQCAAQD+gICA/gCAAYCAgICAAQD/AICAAQD+gAGAgICAAQD/AIABAP8AgICAAAAIAAAAAAKAA4AAAwAJAA0AEQAVABkAHQAhAAAxNTMVIREzFTMVJREzESU1MxUlNTMVNREzESURMxElNTMVgAEAgID+AIABAID+gICA/gCAAYCAgIABAICAgAEA/wCAgICAgICAAQD/AIABAP8AgICAAAAAAAUAAAAAAoADgAADAAkADQAbAB8AADE1MxUhNSMRIREBETMRAREjNTM1IxEhETMVIxEBNTMVgAGAgAEA/wCA/oCAgIABAICAAQCAgICAAQD+gAIAAQD/AP6AAQCAgAEA/oCA/wACgICAAAAAAAYAAAAAAoADgAADAAcACwAPABMAFwAAMzUhFT0BMxUhETMZATUzFT0BMxUDNTMVgAGAgP2AgICAgICAgICAgAEA/wABAICAgICAAQCAgAAABAAAAAACgAUAAAsADwATABcAADERMxEhETMRIxEhGQE1IRUBNTMVJTUzFYABgICA/oABgP8AgP8AgAMA/wABAP0AAYD+gAMAgIABAICAgICAAAAABAAAAAACgAUAAAsADwATABcAADERMxEhETMRIxEhGQE1IRUBNTMVPQEzFYABgICA/oABgP8AgIADAP8AAQD9AAGA/oADAICAAQCAgICAgAAFAAAAAAKABQAACwAPABMAFwAbAAAxETMRIREzESMRIRkBNSEVATUzFTM1MxUlNTMVgAGAgID+gAGA/oCAgID/AIADAP8AAQD9AAGA/oADAICAAQCAgICAgICAAAMAAAAAAoAEgAALAA8AEwAAMREzESERMxEjESEZATUhFQE1IRWAAYCAgP6AAYD+gAGAAwD/AAEA/QABgP6AAwCAgAEAgIAAAAQAAAAAAoAEgAALAA8AEwAXAAAxETMRIREzESMRIRkBNSEVATUhFTM1IRWAAYCAgP6AAYD+AAEAgAEAAwD/AAEA/QABgP6AAwCAgAEAgICAgAAAAAMAAAAAAoAEgAALABMAFwAAMREzESERMxEjESEZAjMVMzUzEQE1MxWAAYCAgP6AgICA/wCAAwD/AAEA/QABgP6AAwABAICA/wABAICAAAAAAQAAAAACgAOAABUAADERMxUzNSM1IRUhFTMVIxEhFSERIxGAgIACAP8AgIABAP6AgAMAgICAgICA/oCAAgD+AAAAAAAHAAD/AAKAA4AABwALAA8AEwAXABsAHwAAATUjNSEVMxUDNTMVJTUhFT0BMxUhETMRATUzFSU1IRUBgIABAICAgP4AAYCA/YCAAYCA/gABgP8AgICAgAEAgICAgICAgIACAP4AAYCAgICAgAADAAAAAAKABQAACwAPABMAADERIRUhFSEVIREhFQE1MxUlNTMVAoD+AAEA/wACAP6AgP8AgAOAgICA/oCABACAgICAgAAAAAADAAAAAAKABQAACwAPABMAADERIRUhFSEVIREhFQE1MxU9ATMVAoD+AAEA/wACAP6AgIADgICAgP6AgAQAgICAgIAAAAQAAAAAAoAFAAALAA8AEwAXAAAxESEVIRUhFSERIRUBNTMVMzUzFSU1MxUCgP4AAQD/AAIA/gCAgID/AIADgICAgP6AgAQAgICAgICAgAAAAwAAAAACgASAAAsADwATAAAxESEVIRUhFSERIRUBNSEVMzUhFQKA/gABAP8AAgD9gAEAgAEAA4CAgID+gIAEAICAgIAAAAAAAwAAAAABAAQAAAMABwALAAAzETMRAzUzFSU1MxWAgICA/wCAAoD9gAMAgICAgIAAAwCAAAABgAQAAAMABwALAAAzETMRAzUzFT0BMxWAgICAgAKA/YADAICAgICAAAAABAAAAAABgAQAAAMABwALAA8AADMRMxEBNTMVMzUzFSU1MxWAgP8AgICA/wCAAoD9gAMAgICAgICAgAAAAwAAAAABgAOAAAMABwALAAAzETMRATUzFTM1MxWAgP8AgICAAoD9gAMAgICAgAAAAv+AAAACgAOAAAMAEwAAJREzEQURIzUzESEVIREhFSERIRUCAID9gICAAgD+gAEA/wABgIACgP2AgAGAgAGAgP8AgP8AgAAABAAAAAACgASAAAMACwATABcAAAE1MxUBETMVMxUjESERIzUzETMRATUhFQEAgP6AgICAAYCAgID+AAGAAgCAgP4AA4CAgP2AAYCAAYD8gAQAgIAABgAAAAACgAUAAAMABwALAA8AEwAXAAAzNSEVJREzESERMxEBNSEVATUzFSU1MxWAAYD+AIABgID+AAGA/wCA/wCAgICAAoD9gAKA/YACgICAAQCAgICAgAAAAAAGAAAAAAKABQAAAwAHAAsADwATABcAADM1IRUlETMRIREzEQE1IRUBNTMVPQEzFYABgP4AgAGAgP4AAYD/AICAgICAAoD9gAKA/YACgICAAQCAgICAgAAABgAAAAACgAUAAAMABwALAA8AFQAZAAAzNSEVJREzESERMxEBNTMVAzUhETMRATUzFYABgP4AgAGAgP4AgIABAID/AICAgIACgP2AAoD9gAOAgID/AIABAP6AAYCAgAAABQAAAAACgASAAAMABwALAA8AEwAAMzUhFSURMxEhETMRATUhFQE1IRWAAYD+AIABgID+AAGA/oABgICAgAKA/YACgP2AAoCAgAEAgIAAAAAGAAAAAAKABIAAAwAHAAsADwATABcAADM1IRUlETMRIREzEQE1IRUBNSEVMzUhFYABgP4AgAGAgP4AAYD+AAEAgAEAgICAAoD9gAKA/YACgICAAQCAgICAAAAAAAkAAACAAoADAAADAAcACwAPABMAFwAbAB8AIwAAPQEzFSE1MxUlNTMVMzUzFSU1MxUlNTMVMzUzFSU1MxUhNTMVgAGAgP4AgICA/wCA/wCAgID+AIABgICAgICAgICAgICAgICAgICAgICAgICAgAAFAAAAAAKAA4AAAwAHAA8AFwAbAAAzNSEVATUzFQERMxEzFSMVIREjNTM1MxEBNSEVgAGA/wCA/oCAgIABgICAgP4AAYCAgAGAgID/AAKA/oCAgAGAgID9gAKAgIAAAAAFAAAAAAKABIAAAwAHAAsADwATAAAzNSEVJREzESERMxEBNTMVJTUzFYABgP4AgAGAgP6AgP8AgICAgAMA/QADAP0AAwCAgICAgAAABQAAAAACgASAAAMABwALAA8AEwAAMzUhFSURMxEhETMRATUzFT0BMxWAAYD+AIABgID+gICAgICAAwD9AAMA/QADAICAgICAAAAAAAQAAAAAAoAEgAADAAcACwAPAAAzNSEVJREzESERMxEBNSEVgAGA/gCAAYCA/gABgICAgAMA/QADAP0AA4CAgAAFAAAAAAKABIAAAwAHAAsADwATAAAzNSEVJREzESERMxEBNSEVMzUhFYABgP4AgAGAgP2AAQCAAQCAgIADAP0AAwD9AAOAgICAgAAABwAAAAACgASAAAMABwALAA8AEwAXABsAACERMxEBNTMVMzUzFSU1MxUhNTMVJTUzFT0BMxUBAID/AICAgP4AgAGAgP6AgIACgP2AAoCAgICAgICAgICAgICAgIAAAAAAAgAAAAACAAOAAAMADwAAAREzEQERMxUhFSERIRUhFQGAgP4AgAEA/wABAP8AAQABgP6A/wADgICA/oCAgAAAAAQAAAAAAoADgAAFAAkADQATAAAhNSERMxEBNTMVNREzEQERIRUhEQEAAQCA/wCAgP2AAgD+gIABAP6AAYCAgIABAP8A/gADgID9AAAFAAAAAAKAA4AAAwAHAA0AEQAVAAAzNSEVJTUzFT0BITUzEQE1IRUBNSEVgAIA/YCAAYCA/gABgP4AAQCAgICAgICAgP8AAQCAgAEAgIAAAAQAAAAAAoADgAADAA0AEQAVAAA9ATMdATUhNSE1ITUzEQE1IRUDNSEVgAGA/oABgID+AAGAgAEAgICAgICAgID+AAIAgIABAICAAAAEAAAAAAKAA4AAAwANABEAFQAAPQEzHQE1ITUhNSE1MxEBNSEVATUzFYABgP6AAYCA/gABgP8AgICAgICAgICA/gACAICAAQCAgAAABAAAAAACgAOAAAMADQARABUAAD0BMx0BNSE1ITUhNTMRATUhFQE1IRWAAYD+gAGAgP4AAYD+gAGAgICAgICAgID+AAIAgIABAICAAAUAAAAAAoADgAADAA0AEQAVABkAAD0BMx0BNSE1ITUhNTMRATUhFQE1MxUzNTMVgAGA/oABgID+AAGA/oCAgICAgICAgICAgP4AAgCAgAEAgICAgAAAAAAGAAAAAAKAA4AAAwANABEAFQAZAB0AAD0BMx0BNSE1ITUhNTMRATUhFSU1MxUhNTMVJTUhFYABgP6AAYCA/gABgP4AgAGAgP4AAYCAgICAgICAgP4AAgCAgICAgICAgICAAAAABAAAAAACgAKAAAMAFQAZAB0AAD0BMx0BNTM1IzUzNTMVMzUzESEVIRUBNTMVMzUzFYCAgICAgID/AAEA/gCAgICAgICAgICAgICA/wCAgAIAgICAgAAAAAgAAP8AAoADAAADAAcACwAPABMAFwAbAB8AABE1IRU9ASEVPQEzFSU1IRU9ATMVIREzEQE1MxUlNSEVAQABAID+AAGAgP2AgAGAgP4AAYD/AICAgICAgICAgICAgICAAYD+gAEAgICAgIAAAAQAAAAAAoADgAADAA0AEQAVAAAzNSEVJREzFSE1MxEhFRE1IRUBNSEVgAIA/YCAAYCA/gABgP4AAQCAgIABgICA/wCAAYCAgAEAgIAAAAAABAAAAAACgAOAAAMADQARABUAADM1IRUlETMVITUzESEVETUhFQM1IRWAAgD9gIABgID+AAGAgAEAgICAAYCAgP8AgAGAgIABAICAAAQAAAAAAoADgAADAA0AEQAVAAAzNSEVJREzFSE1MxEhFRE1IRUBNTMVgAGA/gCAAYCA/gABgP8AgICAgAGAgID/AIABgICAAQCAgAAFAAAAAAKAA4AAAwANABEAFQAZAAAzNSEVJREzFSE1MxEhFRE1IRUBNSEVMzUhFYABgP4AgAGAgP4AAYD+AAEAgAEAgICAAYCAgP8AgAGAgIABAICAgIAAAgAAAAABAAQAAAMABwAAMxEzEQERMxGAgP8AgAKA/YADAAEA/wAAAAIAAAAAAQAEAAADAAcAADERMxkCMxGAgAKA/YADAAEA/wAAAAMAAAAAAIAEgAADAAcACwAAMREzEQM1MxUDNTMVgICAgIACgP2AAwCAgAEAgIAAAAQAAAAAAYAEgAADAAcACwAPAAAzETMRAzUzFQE1MxUzNTMVgICAgP8AgICAAoD9gAMAgIABAICAgIAAAAMAAAAAAoAEAAADAAcAFwAANREzGQE1MxUDNSERITUhNSE1MzUzFTMRgICAAYD+gAGA/wCAgICAAYD+gAMAgID8gIABgICAgICA/IAAAAAAAwAAAAACgAOAAAMACQANAAAhETMRIREhFSEZATUhFQIAgP2AAgD+gAGAAgD+AAKAgP4AAwCAgAAFAAAAAAKAA4AAAwAHAAsADwATAAAzNSEVJREzESERMxEBNSEVATUhFYABgP4AgAGAgP4AAYD+AAEAgICAAYD+gAGA/oABgICAAQCAgAAAAAUAAAAAAoADgAADAAcACwAPABMAADM1IRUlETMRIREzEQE1IRUDNSEVgAGA/gCAAYCA/gABgIABAICAgAGA/oABgP6AAYCAgAEAgIAAAAAABgAAAAACgAOAAAMABwALAA8AEwAXAAAzNSEVJREzESERMxEBNSEVPQEzFSU1IRWAAYD+AIABgID+AAGAgP4AAYCAgIABgP6AAYD+gAGAgICAgICAgIAAAAUAAAAAAoADgAADAAcACwAPABMAADM1IRUlETMRIREzEQE1IRUBNSEVgAGA/gCAAYCA/gABgP6AAYCAgIABgP6AAYD+gAGAgIABAICAAAAABgAAAAACgAOAAAMABwALAA8AEwAXAAAzNSEVJREzESERMxEBNSEVATUhFTM1IRWAAYD+AIABgID+AAGA/gABAIABAICAgAGA/oABgP6AAYCAgAEAgICAgAAAAAADAAAAAAMAA4AAAwAHAAsAACERIREBNSEVAREhEQEAAQD+AAMA/gABAAEA/wABgICAAQABAP8AAAMAAAAAAoACgAADAA0AFwAAATUzFQE1IxEzETMVIRU1ESM1ITUhFTMRAQCA/wCAgIABAID/AAGAgAEAgID/AIABgP8AgICAAQCAgID+gAAAAwAAAAACgAOAAAMACQANAAA1ETMRFTUhETMRATUhFYABgID9gAEAgAIA/gCAgAIA/YADAICAAAADAAAAAAKAA4AAAwAJAA0AADURMxEVNSERMxEBNSEVgAGAgP8AAQCAAgD+AICAAgD9gAMAgIAAAAMAAAAAAoADgAADAAkADQAANREzERU1IREzEQE1MxWAAYCA/oCAgAIA/gCAgAIA/YADAICAAAAABAAAAAACgAOAAAMACQANABEAADURMxEVNSERMxEBNTMVMzUzFYABgID+AICAgIACAP4AgIACAP2AAwCAgICAAAUAAP+AAoADgAADAAcADwATABcAABU1IRUBETMRATUhNSERMxEBNTMVPQEzFQIA/gCAAYD+gAGAgP6AgICAgIABgAGA/oD/AICAAYD9gAKAgICAgIAAAAACAAD/gAGAAwAAAwAPAAABNTMVAREzETMVIxUzFSMRAQCA/oCAgICAgAEAgID+gAOA/wCAgID/AAAAAAAFAAD/gAKAA4AAAwAHAA8AEwAXAAAVNSEVAREzEQE1ITUhETMRATUzFTM1MxUCAP4AgAGA/oABgID+AICAgICAgAGAAYD+gP8AgIABgP2AAwCAgICAAAAABwAAAAACgASAAAMABwALAA8AEwAXABsAACERMxEBNTMVMzUzFSU1MxUhNTMVATUhFTM1IRUBAID/AICAgP4AgAGAgP2AAQCAAQACgP2AAoCAgICAgICAgIABAICAgIAAAwAAAAACgAOAAAMACwARAAAhNSEVNREjNTMRMxEFESEVIREBAAEAgICA/YACAP6AgICAAQCAAQD9gIADgID9AAAAAAABAAABgAKAAgAAAwAAETUhFQKAAYCAgAACAAACAAEAA4AAAwAHAAARNTMVNREzEYCAAgCAgIABAP8AAAACAAACAAEAA4AAAwAHAAARNTMVNREzEYCAAgCAgIABAP8AAAACAAAAAAEAAYAAAwAHAAAxNTMVNREzEYCAgICAAQD/AAAAAAACAAACAAEAA4AAAwAHAAATNTMVJREzEYCA/wCAAgCAgIABAP8AAAAABAAAAgACAAOAAAMABwALAA8AABE1MxUzNTMVJREzETMRMxGAgID/AICAgAIAgICAgIABAP8AAQD/AAAABAAAAgACAAOAAAMABwALAA8AABE1MxUzNTMVJREzETMRMxGAgID/AICAgAIAgICAgIABAP8AAQD/AAAABAAAAAACAAGAAAMABwALAA8AADE1MxUzNTMVJREzETMRMxGAgID/AICAgICAgICAAQD/AAEA/wAAAAAAAQAAAAACgAOAAAsAACERITUhETMRIRUhEQEA/wABAIABAP8AAgCAAQD/AID+AAAAAQAAAQABgAKAAAsAABM1IzUzNTMVMxUjFYCAgICAgAEAgICAgICAAAMAAAAAAoABAAADAAcACwAAMREzETMRMxEzETMRgICAgIABAP8AAQD/AAEA/wAAAAUAAACAAYADAAADAAcACwAPABMAACU1MxUlNTMVJTUzFT0BMxU9ATMVAQCA/wCA/wCAgICAgICAgICAgICAgICAgIAABQAAAIABgAMAAAMABwALAA8AEwAAPQEzFT0BMxU9ATMVJTUzFSU1MxWAgID/AID/AICAgICAgICAgICAgICAgIAAAAABAAAAAAKAA4AAFwAAITUjNSMRMzUzNSEVIRUjFSEVIRUzFSEVAQCAgICAAYD/AIABgP6AgAEAgIABgICAgICAgICAgAAAAAABAAACAAMAA4AADwAAExEjNSEVMzUzFTMRITUjFYCAAYCAgID/AIACAAEAgICAgP8AgIAAAwAAAAACgAOAAA0AEQAVAAAzESM1MzUzFSERIxEhGQE1MxUzNTMVgICAgAGAgP8AgICAAgCAgID9gAIA/gADAICAgIAAAAAAAgAAAAACgAOAAAsAEQAAMxEjNTM1MxUzFSMRIREhNSERgICAgICAAQD/AAGAAgCAgICA/gADAID8gAAAAAAeAW4AAQAAAAAAAAAWAC4AAQAAAAAAAQALAF0AAQAAAAAAAgAHAHkAAQAAAAAAAwALAJkAAQAAAAAABAATAM0AAQAAAAAABQALAPkAAQAAAAAABgALAR0AAQAAAAAACAAMAUMAAQAAAAAACQAMAWoAAQAAAAAACgABAXsAAQAAAAAACwAaAbMAAQAAAAAADAAaAgQAAQAAAAAADQAoAnEAAQAAAAAADgAuAvgAAQAAAAAAEwApA3sAAwABBAkAAAAsAAAAAwABBAkAAQAWAEUAAwABBAkAAgAOAGkAAwABBAkAAwAWAIEAAwABBAkABAAmAKUAAwABBAkABQAWAOEAAwABBAkABgAWAQUAAwABBAkACAAYASkAAwABBAkACQAYAVAAAwABBAkACgACAXcAAwABBAkACwA0AX0AAwABBAkADAA0Ac4AAwABBAkADQBQAh8AAwABBAkADgBcApoAAwABBAkAEwBSAycAQwBvAHAAeQByAGkAZwBoAHQAIABBAG4AZAByAGUAdwAgAFQAeQBsAGUAcgAAQ29weXJpZ2h0IEFuZHJldyBUeWxlcgAATQBpAG4AZQBjAHIAYQBmAHQAaQBhAABNaW5lY3JhZnRpYQAAUgBlAGcAdQBsAGEAcgAAUmVndWxhcgAATQBpAG4AZQBjAHIAYQBmAHQAaQBhAABNaW5lY3JhZnRpYQAATQBpAG4AZQBjAHIAYQBmAHQAaQBhACAAUgBlAGcAdQBsAGEAcgAATWluZWNyYWZ0aWEgUmVndWxhcgAAVgBlAHIAcwBpAG8AbgAgADEALgAwAABWZXJzaW9uIDEuMAAATQBpAG4AZQBjAHIAYQBmAHQAaQBhAABNaW5lY3JhZnRpYQAAQQBuAGQAcgBlAHcAIABUAHkAbABlAHIAAEFuZHJldyBUeWxlcgAAQQBuAGQAcgBlAHcAIABUAHkAbABlAHIAAEFuZHJldyBUeWxlcgAACgAACgAAaAB0AHQAcAA6AC8ALwB3AHcAdwAuAGEAbgBkAHIAZQB3AHQAeQBsAGUAcgAuAG4AZQB0AABodHRwOi8vd3d3LmFuZHJld3R5bGVyLm5ldAAAaAB0AHQAcAA6AC8ALwB3AHcAdwAuAGEAbgBkAHIAZQB3AHQAeQBsAGUAcgAuAG4AZQB0AABodHRwOi8vd3d3LmFuZHJld3R5bGVyLm5ldAAAQwByAGUAYQB0AGkAdgBlACAAQwBvAG0AbQBvAG4AcwAgAEEAdAB0AHIAaQBiAHUAdABpAG8AbgAgAFMAaABhAHIAZQAgAEEAbABpAGsAZQAAQ3JlYXRpdmUgQ29tbW9ucyBBdHRyaWJ1dGlvbiBTaGFyZSBBbGlrZQAAaAB0AHQAcAA6AC8ALwBjAHIAZQBhAHQAaQB2AGUAYwBvAG0AbQBvAG4AcwAuAG8AcgBnAC8AbABpAGMAZQBuAHMAZQBzAC8AYgB5AC0AcwBhAC8AMwAuADAALwAAaHR0cDovL2NyZWF0aXZlY29tbW9ucy5vcmcvbGljZW5zZXMvYnktc2EvMy4wLwAARgBpAHYAZQAgAGIAaQBnACAAcQB1AGEAYwBrAGkAbgBnACAAegBlAHAAaAB5AHIAcwAgAGoAbwBsAHQAIABtAHkAIAB3AGEAeAAgAGIAZQBkAABGaXZlIGJpZyBxdWFja2luZyB6ZXBoeXJzIGpvbHQgbXkgd2F4IGJlZAAAAAIAAAAAAAAAYgAzAAAAAAAAAAAAAAAAAAAAAAAAAAAA1AAAAQIBAwADAAQABQAGAAcACAAJAAoACwAMAA0ADgAPABAAEQASABMAFAAVABYAFwAYABkAGgAbABwAHQAeAB8AIAAhACIAIwAkACUAJgAnACgAKQAqACsALAAtAC4ALwAwADEAMgAzADQANQA2ADcAOAA5ADoAOwA8AD0APgA/AEAAQQBCAEMARABFAEYARwBIAEkASgBLAEwATQBOAE8AUABRAFIAUwBUAFUAVgBXAFgAWQBaAFsAXABdAF4AXwBgAGEAowCEAIUAvQCWAOgAhgCOAIsAnQCpAKQBBACKANoAgwCTAQUBBgCNAQcAiADDAN4BCACeAKoA9QD0APYAogCtAMkAxwCuAGIAYwCQAGQAywBlAMgAygDPAMwAzQDOAOkAZgDTANAA0QCvAGcA8ACRANYA1ADVAGgA6wDtAIkAagBpAGsAbQBsAG4AoABvAHEAcAByAHMAdQB0AHYAdwDqAHgAegB5AHsAfQB8ALgAoQB/AH4AgACBAOwA7gC6ALsBCQCzALYAtwDEAQoAtAC1AMUAggCHAKsAvgC/AQsAjAEMAQ0GZ2x5cGgxBmdseXBoMgd1bmkwMEFEB3VuaTAwQjIHdW5pMDBCMwd1bmkwMEI1B3VuaTAwQjkHdW5pMUU5RQ1xdW90ZXJldmVyc2VkBEV1cm8HdW5pRkIwMQd1bmlGQjAyAAAAAAH//wACAAEAAAAOAAAAGAAgAAAAAgABAAEA0wABAAQAAAACAAAAAQAAAAEAAAAAAAEAAAAAyYlvMQAAAADK8HqtAAAAAMtPFqk=)");
const logoElement = document.getElementById("logo");
var flashingText = document.createElement("div");
flashingText.id = "flashingtext";
var messages = [
"Created by towelgreen (and kk)",
"Also try fortmine!",
"kkkkkkkkkk",
":3",
"UWU~~~",
"Lapamauve is gay",
"No updates since 1998!",
"I'm gonna touch you",
"No skill issues, just lags!",
"Try bingo!",
"kill yourself!",
"What a day, huh?",
"Crashes occasionaly!",
"Watch out for cheaters!",
"G.CONFIG.a143=100",
"Sprechen sie deutsch?",
"Always nice weather!",
"Don't forget to have fun!",
"Rocks are OP!",
"*blushes*",
"Welcome Back, again!",
"What are you looking at?",
"Miku Miku oo ee oo",
"Never Gonna Give You Up",
"( ͡° ͜ʖ ͡°)",
"Nuh uh uh!",
"BOO! are you scared?",
"what are you doing today?",
". . .",
"",
"Powered by magic!",
"The Game!"
];
var randomMessage = messages[Math.floor(Math.random() * messages.length)];
// Set the innerText to the random message
flashingText.innerText = randomMessage;
logoElement.parentElement.appendChild(flashingText);
// Apply your styles
flashingText.style.position = "absolute";
flashingText.style.top = "-13%"; // Place it near the top of the page, adjust as needed
flashingText.style.left = "36%"; // Adjust horizontal position as needed
flashingText.style.transform = "translateX(-50%) rotate(-13deg)"; // Center and rotate
flashingText.style.margin = "0";
flashingText.style.width = "40%";
flashingText.style.animation = "FlashingText 0.5s ease-in-out infinite";
flashingText.style.color = "#FFFF00";
flashingText.style.fontSize = "20px";
flashingText.style.zIndex = "9999";
flashingText.style.fontFamily = "Minecraftia";
flashingText.style.textShadow = "#343c03 2px 2px";
// Dynamically create and append the @keyframes for the animation
// Create a <style> tag
const styleTag = document.createElement("style");
styleTag.innerHTML = `
input#customServer {
color: #ffffff !important;
}
`;
// Append the <style> tag to the <head>
document.head.appendChild(styleTag);
const styleSheet = document.createElement("style");
styleSheet.innerHTML = `
@keyframes FlashingText {
0% { transform: scale(1) rotate(-13deg); }
50% { transform: scale(1.05) rotate(-13deg); }
100% { transform: scale(1) rotate(-13deg); }
}
`;
document.head.appendChild(styleSheet);
var checkElementsInterval = setInterval(function() {
var customServerInput = document.getElementById("customServer");
var el = document.getElementById('cross-promo')
var discord = document.getElementById("discord");
var topleft = document.getElementById("topleft");
var playBtn = document.getElementById("playbtn");
// var customServerInput = document.getElementById("customServer");
var rightwrap = document.getElementById("rightwrap");
if (el && discord && topleft && !playBtn.disabled) {
rightwrap.style.display = "none"; //hide thingy to the right
customServerInput.style.setProperty("color", "#ffffff", "important");
customServerInput.style.height = "63px";
customServerInput.style.width = "100%";
customServerInput.style.textAlign = "center";
customServerInput.style.fontSize = "15px";
customServerInput.style.fontFamily = "Minecraftia";
customServerInput.style.color = "#ffffff";
customServerInput.style.background = "#5e5e5e";
customServerInput.style.textShadow = "rgba(0, 0, 0, 0.667) 2px 2px";
customServerInput.style.boxShadow = "rgba(0, 0, 0, 0.267) 2px 4px inset, rgba(255, 255, 255, 0.333) -2px -2px inset";
// Select the Play button element
playBtn = document.getElementById("playbtn");
// Apply the Minecraft-themed styles
playBtn.style.cursor = "pointer";
playBtn.style.overflow = "hidden";
playBtn.style.whiteSpace = "nowrap";
playBtn.style.userSelect = "none";
// Background and border
playBtn.style.background = "#999 url('https://i.ibb.co/rb2TWXL/bgbtn.png') center / cover";
playBtn.style.imageRendering = "pixelated";
playBtn.style.border = "2px solid #000";
// Text styles
playBtn.style.color = "#DDD"; // Title text color
playBtn.style.textShadow = "2px 2px #000A"; // Title text shadow
playBtn.style.boxShadow = "inset -2px -4px #0006, inset 2px 2px #FFF7"; // Title box shadow
playBtn.style.fontFamily = "'Minecraftia', sans-serif"; // Add the font-family
playBtn.style.fontSize = "12pt"; // Ensure the font size is similar to the original
// Load the Minecraftia font (if it’s hosted externally or locally)
fontFace.load().then(function (loadedFont) {
// Add it to the document
document.fonts.add(loadedFont);
console.log("Minecraftia font loaded and applied!");
}).catch(function (err) {
console.error("Failed to load Minecraftia font!", err);
});
// Add hover effect using event listeners
playBtn.addEventListener("mouseover", () => {
playBtn.style.backgroundColor = "rgba(100, 100, 255, 0.45)";
playBtn.style.textShadow = "2px 2px #202013CC";
playBtn.style.color = "#FFFFA0";
});
playBtn.addEventListener("mouseout", () => {
playBtn.style.backgroundColor = "";
playBtn.style.textShadow = "2px 2px #000A";
playBtn.style.color = "#DDD";
});
// Add active effect using event listeners
playBtn.addEventListener("mousedown", () => {
playBtn.style.boxShadow = "inset -2px -4px #0004, inset 2px 2px #FFF5";
});
playBtn.addEventListener("mouseup", () => {
playBtn.style.boxShadow = "inset -2px -4px #0006, inset 2px 2px #FFF7";
});
el.remove();
var newEl = document.createElement("div");
newEl.id = "CheatNite";
var anchor = document.createElement("a");
anchor.textContent = "CheatNite Enhanced loaded!";
anchor.href = "https://discord.gg/ye3bXsm6Qx";
anchor.style.fontSize = "2em";
newEl.appendChild(anchor);
topleft.appendChild(newEl);
console.log('CheatNite Enhanced loaded!');
discord.href = "https://discord.gg/ye3bXsm6Qx";
playBtn.removeAttribute("onclick");
playBtn.onclick = customStartBtn;
replaceVideoSource("https://cdn.pixabay.com/video/2024/11/24/243091.mp4");
replaceImageSource("https://i.imgur.com/vBmhMgN.png");
clearInterval(checkElementsInterval);
}
}, 500);
/*
KEYBINDS
*/
//add fly/creative-mode keybind
document.addEventListener("keydown", function(event) {
// check if 'f' key is pressed
if (typeof(cheatnite) !== 'undefined' && document.activeElement && document.activeElement.tagName !== 'INPUT' && event.key === "f") {
// Toggle the value of G.CONFIG.a143
if (typeof(G) !== 'undefined' && typeof(G.CONFIG) !== 'undefined' && typeof(G.CONFIG.a143) !== 'undefined') {
G.CONFIG.a143 = !G.CONFIG.a143;
if (!G.CONFIG.a143) {
G.CONFIG.a155 = 0.1;
G.CONFIG.a156 = 0.3
cheatnite.fly = false;
} else {
G.CONFIG.a155 = 100;
G.CONFIG.a156 = 2;
cheatnite.fly = true;
}
modifyCheatDisp("fly");
}
}
});
let isMouseDown = false;
document.addEventListener('mousedown', (event) => {
if (event.button === 0) { // If left mouse button is pressed
isMouseDown = true;
}
});
document.addEventListener('mouseup', () => {
isMouseDown = false;
});
//chatspam. Also a good example of keybinded-spam
document.addEventListener('keydown', (event) => {
if (typeof(cheatnite) !== 'undefined' && document.activeElement && document.activeElement.tagName !== 'INPUT') {
// Check if 'q' is pressed.
if (event.key === 'q') {
// If setInterval is running, clear it
if (cheatnite.chatspam) {
clearInterval(cheatnite.chatspam);
cheatnite.chatspam = null;
cheatnite.chatspam_count = 0; // Reset count
cheatnite.chatspam_line = 0; // Reset line index
}
// Else start a new setInterval
else {
var lines = [
"▉▊▋▌▍▎▏▎▍▌▋▊▉▉▊▋▌▍▎▏▎▍▌▋▊▉",
"▊▋▌▍▎▏▎▍▌▋▊▉▉▊▋▌▍▎▏▎▍▌▋▊▉▉",
"▋▌▍▎▏▎▍▌▋▊▉▉▊▋▌▍▎▏▎▍▌▋▊▉▉▊",
"▌▍▎▏▎▍▌▋▊▉▉▊▋▌▍▎▏▎▍▌▋▊▉▉▊▋",
"▍▎▏▎▍▌▋▊▉▉▊▋▌▍▎▏▎▍▌▋▊▉▉▊▋▌",
"▎▏▎▍▌▋▊▉▉▊▋▌▍▎▏▎▍▌▋▊▉▉▊▋▌▍",
"▏▎▍▌▋▊▉▉▊▋▌▍▎▏▎▍▌▋▊▉▉▊▋▌▍▎",
"▎▍▌▋▊▉▉▊▋▌▍▎▏▎▍▌▋▊▉▉▊▋▌▍▎▏",
"▍▌▋▊▉▉▊▋▌▍▎▏▎▍▌▋▊▉▉▊▋▌▍▎▏▎",
"▌▋▊▉▉▊▋▌▍▎▏▎▍▌▋▊▉▉▊▋▌▍▎▏▎▍",
"▋▊▉▉▊▋▌▍▎▏▎▍▌▋▊▉▉▊▋▌▍▎▏▎▍▌",
"▊▉▉▊▋▌▍▎▏▎▍▌▋▊▉▉▊▋▌▍▎▏▎▍▌▋",
"▉▉▊▋▌▍▎▏▎▍▌▋▊▉▉▊▋▌▍▎▏▎▍▌▋▊",
];
cheatnite.chatspam_line = 0; // Start from the first line
cheatnite.chatspam = setInterval(() => {
if (cheatnite.auto || isMouseDown) {
var e = new a201();
e.msg = lines[cheatnite.chatspam_line]; // Cycle through the lines
cheatnite.chatspam_line = (cheatnite.chatspam_line + 1) % lines.length; // Increment and wrap around
cheatnite.chatspam_count++;
if (cheatnite.chatspam_count >= 1000)
cheatnite.chatspam_count = 0;
G.socket.send(e.a614());
}
}, 2000);
}
modifyCheatDisp("chatspam");
}
}
});
//bulletspam
document.addEventListener('keydown', (event) => {
if (typeof(cheatnite) !== 'undefined' && document.activeElement && document.activeElement.tagName !== 'INPUT') {
if (event.key === 'r' && !event.metaKey && !event.ctrlKey) {
// If setInterval is running, clear it
if (cheatnite.bulletspam) {
clearInterval(cheatnite.bulletspam);
cheatnite.bulletspam = null;
}
// Else start a new setInterval
else {
cheatnite.bulletspam = setInterval(() => {
if (typeof(GAME) === 'undefined' || !GAME?.a865?.player || GAME.a865.player.dead) {
clearInterval(cheatnite.bulletspam);
cheatnite.bulletspam = null;
}
if (cheatnite.auto || isMouseDown) {
shoot("shotgun")
new Audio('https://minecraft.wiki/images/transcoded/Click_stereo.ogg/Click_stereo.ogg.mp3').play();
}
}, 100);
}
modifyCheatDisp("bulletspam");
}
}
});
//autorespawn
document.addEventListener('keydown', (event) => {
if (typeof(cheatnite) !== 'undefined' && document.activeElement && document.activeElement.tagName !== 'INPUT') {
if (event.key === 'x' && !event.metaKey && !event.ctrlKey) {
// If setInterval is running, clear it
if (cheatnite.autorespawn) {
clearInterval(cheatnite.autorespawn);
cheatnite.autorespawn = null;
}
// Else start a new setInterval
else {
cheatnite.autorespawn = setInterval(() => {
if (typeof(GAME) === 'undefined' || !GAME?.a865?.player || GAME.a865.player.dead) {
clearInterval(cheatnite.autorespawn);
cheatnite.autorespawn = null;
}
if (cheatnite.auto || isMouseDown) {
GAME.a865.player.respawn()
}
}, 100);
}
modifyCheatDisp("autorespawn");
}
}
});
//throw items
document.addEventListener('keydown', (event) => {
if (typeof(cheatnite) !== 'undefined' && document.activeElement && document.activeElement.tagName !== 'INPUT') {
if (event.key === 't' && !event.metaKey && !event.ctrlKey) {
// If setInterval is running, clear it
if (cheatnite.tntspam) {
clearInterval(cheatnite.tntspam);
cheatnite.tntspam = null;
}
// Else start a new setInterval
else {
cheatnite.tntspam = setInterval(() => {
if (typeof(GAME) === 'undefined' || !GAME?.a865?.player || GAME.a865.player.dead) {
clearInterval(cheatnite.tntspam);
cheatnite.tntspam = null;
}
if (cheatnite.auto || isMouseDown) {
throwItem("tnt")
}
}, 30);
}
modifyCheatDisp("tntspam");
}
}
});
//zoom
let isZoomedIn = false;
document.addEventListener('keydown', function(event) {
if (typeof(cheatnite) !== 'undefined' && document.activeElement && document.activeElement.tagName !== 'INPUT' && event.key === 'z' && !isZoomedIn) {
GAME.updateZoom(4);
isZoomedIn = true;
modifyCheatDisp("zoom (4x)");
}
});
document.addEventListener('keyup', function(event) {
if (typeof(cheatnite) !== 'undefined' && document.activeElement && document.activeElement.tagName !== 'INPUT' && event.key === 'z' && isZoomedIn) {
GAME.updateZoom(1);
isZoomedIn = false;
modifyCheatDisp("zoom (4x)");
}
});
//move bedrock floor
//credits: https://greasyfork.org/en/scripts/462757-craftnite-io-cheat
document.addEventListener('keydown', function(event) {
if (document.activeElement && document.activeElement.tagName !== 'INPUT' && event.key === 'Shift') {
cheatnite.shiftKeyPressed = true;
G.CONFIG.environmentOceanFloorHeight = -10000;
}
});
document.addEventListener('keyup', function(event) {
if (document.activeElement && document.activeElement.tagName !== 'INPUT' && event.key === 'Shift') {
cheatnite.shiftKeyPressed = false;
G.CONFIG.environmentOceanFloorHeight = 260;
}
});
// ESP
document.addEventListener('keydown', (event) => {
if (typeof(cheatnite) !== 'undefined' && document.activeElement && document.activeElement.tagName !== 'INPUT' && event.key === 'e') {
cheatnite.esp = !cheatnite.esp;
modifyCheatDisp('ESP');
}
});
// /item command
document.addEventListener('keydown', (event) => {
if (typeof(cheatnite) !== 'undefined' && document.activeElement && document.activeElement.tagName !== 'INPUT' && event.key === 'c' && !event.metaKey && !event.ctrlKey) {
cheatnite.customBlockId = getLookAtBlockId();
cheatnite.updateCheatDisp = true;
if (!cheatnite.customBlockId) {
addCustomChat('<', 'Reset stone items.');
return;
}
var stoneNeeded = 1000 - countItemInInv("stone");
if (stoneNeeded > 0) {
GAME.a865.player.a458("stone", stoneNeeded);
}
// Find the block name for the customBlockId
const blockEntry = Object.entries(blocks).find(([name, id]) => id === cheatnite.customBlockId);
const blockName = blockEntry ? blockEntry[0] : 'Unknown';
const blockId = cheatnite.customBlockId;
addCustomChat('<', `Thrown stone set to ${blockName} ${blockId}.`);
}
});
// screenshot
document.addEventListener('keydown', (event) => {
if (typeof(cheatnite) !== 'undefined' && document.activeElement && document.activeElement.tagName !== 'INPUT' && event.key === 'p' && typeof(GAME) !== 'undefined' && GAME?.renderer) {
if (cheatnite.esp)
hidePlayerBoxes();
saveScene();
if (cheatnite.esp)
showPlayerBoxes();
}
});
// noclip
document.addEventListener('keydown', (event) => {
if (typeof(cheatnite) !== 'undefined' && document.activeElement && document.activeElement.tagName !== 'INPUT' && event.key === 'n') {
cheatnite.noclip = !cheatnite.noclip;
modifyCheatDisp("noclip");
}
});
// ctrl-c and ctrl-v
document.addEventListener('keydown', (event) => {
if (typeof(cheatnite) !== 'undefined' && document.activeElement && document.activeElement.tagName !== 'INPUT') {
if ((event.ctrlKey || event.metaKey) && !cheatnite.shiftKeyPressed) {
if (event.key === 'c') {
if (cheatnite.worldedit.inprogress) {
WorldEdit.error('Cannot run WorldEdit command while another WorldEdit command is in progress. Run /stop to stop current running WorldEdit command.');
return;
}
if (!cheatnite.worldedit.pos1 || !cheatnite.worldedit.pos2) {
WorldEdit.error('You must set /pos1 and /pos2 before running this worldedit command.');
return;
}
WorldEdit.copy(cheatnite.worldedit.pos1.clone(), cheatnite.worldedit.pos2.clone());
}
else if (event.key === 'v') {
if (cheatnite.worldedit.inprogress) {
WorldEdit.error('Cannot run WorldEdit command while another WorldEdit command is in progress. Run /stop to stop current running WorldEdit command.');
return;
}
if (!cheatnite.worldedit.clipboard[0]) {
WorldEdit.error('Nothing is copied to clipboard.');
return;
}
WorldEdit.paste(GAME.a865.player.position.clone());
} else if (event.key === 'b') {
if (cheatnite.worldedit.inprogress) {
WorldEdit.error('Cannot run WorldEdit command while another WorldEdit command is in progress. Run /stop to stop current running WorldEdit command.');
return;
}
const keys = Object.keys(cheatnite.worldedit.builds);
if (keys.length === 0) {
WorldEdit.error('You do not have any builds.')
return;
}
WorldEdit.build(keys[keys.length - 1], GAME.a865.player.position.clone());
}
}
}
});
// invisible
document.addEventListener('keydown', (event) => {
if (typeof(cheatnite) !== 'undefined' && document.activeElement && document.activeElement.tagName !== 'INPUT' && event.key === 'i') {
cheatnite.invisible = !cheatnite.invisible;
tp(GAME.a865.player.position, false);
modifyCheatDisp("invisible");
}
});